SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09596
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Integrin beta      
Location in the cell
Mitochondrial   Reliability : 2.431
 

Sequence

CDS
ATGAAACAGCGAAGGGAAACTGCAGATGCTGCTCCGTCAGATAGAAAAACTATAAACACTAAAATCAAAAAACTGATTAGGCGTGACCTTCGCCAATTCAACACAACAAAGATTAAAGAGGCAATAGAACAAAACAAAGGCACCAAAGTGTTTATACGGCAGCAACAACTAGGCCGAAGCCATCTGACGAAGCTCAAAACTGCCGATGGAAGAACTGTTAACTCAAGATCAGAAGTCCTCACTGAAGTGGAGAACTACTACCGTAGTCTCTATGCCTCACATGCTCCCAAACCCTTTGCCCACCCAGAGAATGATCACCGAGCCCCTTTAGTCCGCCACTATACGGAAGACATACCCGACGTCAGTATAGAGGAGATAAGGGCTACTTTGGAACAGCTTAGAAATAACAGAGCTACAGGGGATGACGGAATTAGTACAGAATTGTTGAAAGCAAGTGGTACACCAGTTCTCAACCAATTATGCACAACGTTCAACACCGTCATCCAAAAAACGACTACACCGGAAGCCTGGAGCAAGGGTACTGTTATTCTTTTCTTTAAGAAGGGAGACCGTGCTCTGCTCAAAAACTACAGGCCTATTTCACTTCTTAGCCATATTTATAAGCTGTTCTCGAGAGTCCTTACAAATCGCTTGGCCTCTAGACTTGACGAGTTCCAACCTCCGGAACAGGCTGGGTTTCGCAAAGGCTACAGTACGGTAGACCACATCCACACGCTGAGACAGGTTATTCAGAAGACTGAAGAATACAATCGTCCTCTGTGTCTCGCGTTTGTGGACTACGAAAAAGCCTTCGACTCCATCGAAACTTGGGCTGTTCTGGAATCCTTACAGCGATGCCTAGTCGATTATCGGTACGTTGAGGTGTTGAAGAGTTTATATAAAGCCGCCAAAATGACAGTCCAGATCCAAAACCAGCAGACAAACCCGATTGAGCTTCACAGAGGGGTGAGACAGGGTGACGTTATATCGCCGAAGCTGTTCACTGCTGCTCTAGAGGATGTCTTCAAGACTCTGGACTGGAGTAAACTGGGCATCAATGTCAATGGCGAGTATCATTCACACCTCCGATTTGCGGACGATATCGTTATAATGGCAGAGTCGCTGGAGGATCTCAGCTGTATGCTAGGTGAGCTCAATGCCGCGTCACGACGTGTTGGCCTGGGAATGAATCTGGACAAAACTAAGGTCATGTTCAACGACCATATCATTCCTGGACCGGTAATAGTCGAATCTGCGGTACTCGAAGTTGTGTCTGAATACACCTATCTAGGCCAAATTATTCAGCTGGGCAGGGCCAACTTTGAGAAGGAAGGTGATAGGCGCATACAGTTGGGCTGGGCTGCGTATGGAAAACTCCGTCACATCTTGAACTCAGCAATCCCGCAATGCTTAAAGACAAAAGTTTTCAACGCTTGTGTGCTGCCGGTCATGACATATGGCGCTGAAACGTGGACATTAACCGTAGGTTTGGTCCGTAAGCTCAAAGTCGCTCAGCGTGCTATGGAAAGGTGTATGCTCGGAGTTTCTTTGATGGATCGAGTCAGAAATGATGAAATTCGTCAAAGAACCAAAGTAACCGACATAGTCCTAAAGGTTAGCAAGCTGAAGTGGCAATGGGCCGGACATACGTGTCGCAGAACCGATGGCCGATGGAGCAGACGTGTTCTGGACTGGAGACCGCGTACCGGTAAACGCAGCGTTGGGCGTCCCCCTGCCCGTTGGACCGATGACTTGCGGCGATATGCTGGGAGAGATTGGATGCGGAAGGCGGAGGATCGTTCATTGTGGCGGACTATGGGAGAGGCCTACATCCAGCAGTGGAGAGACACAGGCTGA
Protein
MKQRRETADAAPSDRKTINTKIKKLIRRDLRQFNTTKIKEAIEQNKGTKVFIRQQQLGRSHLTKLKTADGRTVNSRSEVLTEVENYYRSLYASHAPKPFAHPENDHRAPLVRHYTEDIPDVSIEEIRATLEQLRNNRATGDDGISTELLKASGTPVLNQLCTTFNTVIQKTTTPEAWSKGTVILFFKKGDRALLKNYRPISLLSHIYKLFSRVLTNRLASRLDEFQPPEQAGFRKGYSTVDHIHTLRQVIQKTEEYNRPLCLAFVDYEKAFDSIETWAVLESLQRCLVDYRYVEVLKSLYKAAKMTVQIQNQQTNPIELHRGVRQGDVISPKLFTAALEDVFKTLDWSKLGINVNGEYHSHLRFADDIVIMAESLEDLSCMLGELNAASRRVGLGMNLDKTKVMFNDHIIPGPVIVESAVLEVVSEYTYLGQIIQLGRANFEKEGDRRIQLGWAAYGKLRHILNSAIPQCLKTKVFNACVLPVMTYGAETWTLTVGLVRKLKVAQRAMERCMLGVSLMDRVRNDEIRQRTKVTDIVLKVSKLKWQWAGHTCRRTDGRWSRRVLDWRPRTGKRSVGRPPARWTDDLRRYAGRDWMRKAEDRSLWRTMGEAYIQQWRDTG

Summary

Similarity
Belongs to the integrin beta chain family.
Feature
chain  Integrin beta
EMBL
FJ265551    ADI61819.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    + More
FJ265549    ADI61817.1    FJ265545    ADI61813.1    FJ265544    ADI61812.1    RSAL01000057    RVE49824.1    FJ265543    ADI61811.1    RSAL01002130    RVE40575.1    RSAL01002362    RVE40503.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    KZ150072    PZC74016.1    RSAL01000220    RVE44071.1    MRZV01002136    PIK34564.1    KZ149985    PZC75698.1    AAGJ04050748    MRZV01000899    PIK42833.1    AAGJ04144474    KZ150317    PZC71439.1    FJ265564    ADI61832.1    KZ150485    PZC70710.1    FJ265561    ADI61829.1    GFAC01005640    JAT93548.1    KZ150108    PZC73382.1    GBBI01004876    JAC13836.1    ODYU01004088    SOQ43598.1    FJ265562    ADI61830.1    KZ149907    PZC78256.1    GBGD01000453    JAC88436.1    JARK01001677    EYB83167.1    EYB83168.1    GBBI01004877    JAC13835.1    JARK01001340    EYC31295.1    JARK01001351    EYC23395.1    JARK01001655    EYB84321.1    GDKW01001596    JAI54999.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    FJ265563    ADI61831.1    JARK01001362    EYC18843.1    EYC18844.1    JARK01001434    EYC02684.1    JARK01001639    EYB85201.1    JARK01001389    EYC11015.1    ODYU01004982    SOQ45402.1    JARK01000347    EYC38051.1    JARK01000460    EYC36749.1    EYC16151.1    JARK01000732    EYC35149.1    JARK01001626    EYB85833.1    JARK01001621    EYB86109.1    EYC30828.1    JARK01001361    EYC19034.1    JARK01001438    EYC02111.1    JARK01001344    EYC28218.1    JARK01001354    EYC21986.1    JARK01001346    EYC26784.1    JARK01001349    EYC24735.1    EYC02012.1    JARK01001517    EYB93530.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001565    EYB89683.1    JARK01001337    EYC34625.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001711    EYB81734.1    JARK01001568    EYB89432.1    JARK01001543    EYB91353.1    JARK01001378    EYC13977.1    JARK01001343    EYC28635.1    JARK01001406    EYC07496.1    ODYU01008249    SOQ51673.1    JARK01001500    EYB95040.1    EYC28825.1    JARK01001730    EYB81048.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001464    EYB98786.1    JARK01001630    EYB85641.1    JARK01001341    EYC29807.1    JARK01001473    EYB97806.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    EYC16376.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    JARK01001342    EYC29360.1    EYB91355.1    JARK01001348    EYC25050.1    JARK01001502    EYB94855.1    EYC25048.1    CAVP010058791    CDL95187.1    EYB91356.1    EYB98081.1    EYC40601.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00362   Integrin_beta
PF01826   TIL
PF13520   AA_permease_2
PF10323   7TM_GPCR_Srv
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR032695   Integrin_dom_sf       
IPR036465   vWFA_dom_sf       
IPR015812   Integrin_bsu       
IPR002035   VWF_A       
IPR002369   Integrin_bsu_VWA       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR020846   MFS_dom       
IPR002293   AA/rel_permease1       
IPR019426   7TM_GPCR_serpentine_rcpt_Srv       
IPR029052   Metallo-depent_PP-like       
SUPFAM
SSF56219   SSF56219        + More
SSF53300   SSF53300       
SSF69179   SSF69179       
SSF57567   SSF57567       
Gene 3D
PDB
6AR3     E-value=0.0125294,     Score=93

Ontologies

Topology

Subcellular location
Membrane  
Length:
618
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.29018
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00923
outside
1  -  618
 
 

Population Genetic Test Statistics

Pi
404.986635
Theta
184.986435
Tajima's D
3.613704
CLR
0
CSRT
0.995750212489376
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号