SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09589  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA012997
Annotation
glucose_dehydrogenase_[FAD?_quinone]-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.645
 

Sequence

CDS
ATGTTTTGGGCGTGCGACCCAGCGTTAACGACTACTATAGTCAACAGCTACCAGGTAGCGGGGCCGGTCTTCCAGCAGGCCCTGACTACATTCTTGGCTGCGCAATGTGCGATCGCCGGCGATCACTTATGGCCAGCCGATGCTACCGACAAGGTTCTCGAAGATCCAAACTATGACTTCATCGTCGTCGGAGCTGGTTCCGCCGGATCGGCTGTCGCCAATCGTCTTAGCGAAATATCTGACTGGAAAGTGCTTTTAGTCGAAGCCGGTGGTAATCCTACATTGGCAACCGAGATACCGCAACCTTACTACAGTAATATGGGCACATCAGAAGACTGGGCTTACCATACTGAACCACAGGAAGGGGCTTGTCGTGCCTACAAAAACAAGGGATGCGCTTGGCCACGTGGTAAGGTGCTCGGCGGAAGCAGCAGCATCAATTTGATGTTTTACGTTCGAGGTAACAAGGCCGATTACGACGAATGGGCTGCCGATGGAAATGAAGGCTGGAGTTTCGAGGACGTCTTGCCCTACTTTAAGAAAAGTGAAAGCTTCATGGGTAAATTTGACGCGGAGGCGACTAAATACCACAGCAAGGGCGGTTATCTCAGTGTAGCTTCTGACGATAATATGCACGAAATCGAAGATTTGATAATCAAGGCTGCAGTAGAATTAGGACTGAAGAACTTGACCGACTGCAACGGTGACAGCCAAATTGGAGTTATGAAATCGTTCACAACCACCAAGGGTGGAACTAGGTTCAGTACGGCCAGAGCTTTCCTTAGCCCTATCAAGGACAGGAAGAACCTCCATGTCATCAAGAACGCTATCGCCACCAAAATCGTTTTTAAGCCCGGTACCAACATAGTCAGTGGAGTTTTGTTAAACAAAGGTGGGCGTGATATTGCTGTAAATGTAAGGAAAGAAGTTGTCGTTTCCGCTGGTGCTATTAACTCCCCACAGCTGTTGTTGCTCTCCGGAATTGGACCTCGCAAGCACTTGGAAGACCTAAACATTGAAGTTAAAGCCGATTTGCCTGTCGGAGAAAACTTGCAGGACCATTTGTTCGTACCCGTCTTCTATACCAAACCTGGAGACAAGAAAGCTACTACCTTGCCTAATATTATCTCTACTTTCATTGAATACTTCTTGCACAATACTGGCGACTTAATCGACACCAGCCCACACAGAGTTATCGCTTTCGAAAACACAACCGACCCGAACTCTCCTGCTTCTGACATGCAGTACCACTACTTAATATTCCCTCCAAGCTCCTACAACTTGTTGGACATGTTCCGTAAGCACGGTTTAAGCGAAGAAGTCCACGATAAGTTCCGTAAAATGAACGAGAACAAATACACCATGCTCGTTTACAATACTTTGTTGAAACCCAAATCTGCGGGTAGATTGTTATTGAAGACCAAGAATCCATTCGACAAGCCATTATTGTATGCTGATTACTACAAGGATATCGAAGATTTGTACACTGTTATCAGGGCTTTCAAACAGCATAGTTTGAGATTGGGCGAGACCAAAGCCTTCAAGGAATCTGGATTTAAGCTGGAATGGATTGAGTTGGATGCCTGCAAAAGCTTTGATAAGAACAGCGACGAATTCCTAGAATGTATTGCTAGGGAAATTACATTCTCATTGTACCACCCAACGAGTACGGTGAAGATGGGGGCCGATGGTGACCCGACCTCCGTAGTGGACACGAAATTGAGGGTTCGAAACGTTACCGGCCTCAGAGTAATGGACGCAAGTATAATGCCTTCCGTAATCAGAGGTAATACTAACGCTCCTTCTATCATGATCGGTGAGAAAGGAGCTGACATGATCAAGAAGCACTGGCTGCACACGCACACCGAACTATAA
Protein
MFWACDPALTTTIVNSYQVAGPVFQQALTTFLAAQCAIAGDHLWPADATDKVLEDPNYDFIVVGAGSAGSAVANRLSEISDWKVLLVEAGGNPTLATEIPQPYYSNMGTSEDWAYHTEPQEGACRAYKNKGCAWPRGKVLGGSSSINLMFYVRGNKADYDEWAADGNEGWSFEDVLPYFKKSESFMGKFDAEATKYHSKGGYLSVASDDNMHEIEDLIIKAAVELGLKNLTDCNGDSQIGVMKSFTTTKGGTRFSTARAFLSPIKDRKNLHVIKNAIATKIVFKPGTNIVSGVLLNKGGRDIAVNVRKEVVVSAGAINSPQLLLLSGIGPRKHLEDLNIEVKADLPVGENLQDHLFVPVFYTKPGDKKATTLPNIISTFIEYFLHNTGDLIDTSPHRVIAFENTTDPNSPASDMQYHYLIFPPSSYNLLDMFRKHGLSEEVHDKFRKMNENKYTMLVYNTLLKPKSAGRLLLKTKNPFDKPLLYADYYKDIEDLYTVIRAFKQHSLRLGETKAFKESGFKLEWIELDACKSFDKNSDEFLECIAREITFSLYHPTSTVKMGADGDPTSVVDTKLRVRNVTGLRVMDASIMPSVIRGNTNAPSIMIGEKGADMIKKHWLHTHTEL

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
BABH01003797    JQ965926    AFN71166.1    NWSH01000190    PCG78593.1    ODYU01004023    + More
SOQ43474.1    PCG78592.1    RSAL01000051    RVE50264.1    KQ460323    KPJ15963.1    KQ459595    KPI96023.1    BABH01003799    BABH01003798    KPI96022.1    JTDY01008426    KOB64574.1    AK402986    BAM19497.1    KQ460890    KPJ10999.1    NEVH01005904    PNF38181.1    PYGN01000053    PSN56054.1    GGFK01006898    MBW40219.1    GGFK01006105    MBW39426.1    NEVH01020853    PNF21103.1    GGFK01006251    MBW39572.1    GECZ01027417    JAS42352.1    GECZ01013224    JAS56545.1    PNF21087.1    GGFK01008304    MBW41625.1    GBHO01012330    GBRD01008695    GBRD01008694    JAG31274.1    JAG57126.1    APCN01003121    AAAB01008844    EAA06000.3    EGK96367.1    EGK96368.1    GEBQ01028513    JAT11464.1    GDIQ01125583    JAL26143.1    GL448571    EFN84147.1    GECU01033045    JAS74661.1    LBMM01015561    KMQ84762.1    GDIP01122942    GDIQ01046714    JAL80772.1    JAN48023.1    GDIQ01126533    JAL25193.1    GDIP01107286    JAL96428.1    GDIP01189775    GDIP01189774    GDIP01109548    JAJ33628.1    GDIP01107288    JAL96426.1    KK852811    KDR15959.1    GDIP01083296    JAM20419.1    GECU01001143    JAT06564.1    GDIP01109547    JAL94167.1    GECZ01026787    JAS42982.1    GDIP01219777    JAJ03625.1    GFDF01002041    JAV12043.1    GFDF01002039    JAV12045.1    GFDF01002040    JAV12044.1    GFDF01002042    JAV12042.1    LRGB01001036    KZS13782.1    GDIQ01031522    JAN63215.1    DS235784    EEB16968.1    GDIQ01101823    JAL49903.1    GDIQ01032563    JAN62174.1    GDIQ01101824    JAL49902.1    PYGN01000411    PSN46845.1    GDIP01177549    JAJ45853.1    GDIQ01162162    GDIQ01145021    GDIQ01143630    JAL06705.1    GDIQ01131527    JAL20199.1    GDIP01121337    JAL82377.1    GDIQ01051490    JAN43247.1    GDIQ01051491    JAN43246.1    GDIQ01207189    JAK44536.1    GDIQ01126532    JAL25194.1    GDIQ01032564    JAN62173.1    GDIQ01140121    JAL11605.1    GDIQ01251392    JAK00333.1    GDIQ01112973    JAL38753.1    GDIQ01125581    GDIQ01046710    JAN48027.1    GDIQ01182870    JAK68855.1    GDIQ01249887    GDIQ01248344    GDIQ01131526    JAL20200.1    GDIP01216073    JAJ07329.1    GDIQ01044902    JAN49835.1    GDIP01219778    JAJ03624.1    GDIP01092942    JAM10773.1    GDIP01187565    JAJ35837.1    GDIP01177551    JAJ45851.1    GDIQ01251393    GDIQ01251391    GDIQ01035419    JAN59318.1    GDIQ01131578    JAL20148.1    GDIQ01131577    JAL20149.1    GDIQ01130466    JAL21260.1    GDIQ01099134    GDIQ01082045    GDIQ01049912    JAN44825.1    GDIQ01099133    GDIQ01066008    JAN28729.1    GDIQ01198854    JAK52871.1    ADTU01026683    GDIP01131120    JAL72594.1    KQ976532    KYM81564.1    GDIQ01238341    GDIQ01052954    JAN41783.1    GDIQ01234982    GDIQ01162161    GDIQ01115471    GDIQ01112972    GDIQ01099135    GDIQ01049911    JAK89564.1    GDIQ01126530    JAL25196.1    GDIQ01249888    GDIQ01249843    GDIQ01248345    GDIQ01248343    GDIQ01131528    JAK01837.1   
Pfam
PF05199   GMC_oxred_C        + More
PF00732   GMC_oxred_N
Interpro
IPR036188   FAD/NAD-bd_sf        + More
IPR000172   GMC_OxRdtase_N       
IPR012132   GMC_OxRdtase       
IPR007867   GMC_OxRtase_C       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
5OC1     E-value=8.95269e-52,     Score=516

Ontologies

Topology

Length:
624
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0991499999999998
Exp number, first 60 AAs:
0.09451
Total prob of N-in:
0.00467
outside
1  -  624
 
 

Population Genetic Test Statistics

Pi
203.611104
Theta
149.695644
Tajima's D
1.110374
CLR
0.087103
CSRT
0.682965851707415
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26280517 GNIVINDQAAK 96.30 5e-13
26280517 MEAVVFDGK 100.00 0.010
26280517 GITEETTTGVHNIYK 100.00 0.032
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号