SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09586
Pre Gene Modal
BGIBMGA012999
Annotation
PREDICTED:_glucose_dehydrogenase_[FAD?_quinone]-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.447
 

Sequence

CDS
ATGTCGGCGTGTGATCCGACGTTCACTTCGACGGTGATAGGCAGTTACGGAGACGTGGTTGGGACCACGTTCGCTCAAGCACTCACTAGTTTCCTCGCATTACGGAGACGTGAGGATGCTATTAACTCTGTTGTCGATGGTAGTAGCTATGATTTTGTGGTGGTCGGAGCAGGATCAGCCGGTTCAGTCTTGGCAAACCGTTTAAGTGAAGTCCCAGAATGGAAAGTATTACTAGTGGAAGCTGGAGGAAACCCTACCGTGAACACTGAGATACCACAAGTCTTTTATAACAACTTGGGCAGTAAAGAAGACTGGGGTTACCGCCCAGAACCGCAATCCGGCGCTTGTCTCAGTTATGAAACTAAAACATGTGCCTGGCCTAGTGGGAAGACACTCGGTGGCTCCGCAAGTATTAATGCTATGTTCTATGTCAGAGGAAACCACATAGACTTCGATGGATGGGCAGAAGACGGCAACAACGGTTGGAGTTACGAAGATGTTCTTCCTTACTTTAAAAAAAGTGAAAATTTTGTAGCAGATATCTCAGAAAACGATAGATATCATGGCACTAAAGGTGAATTATATACCACAAAAGATAAAAACTTAAAGCCTTTTGAAGAGGTGGTTCTTAAAGCATACCCAGAGTTAGGAGTACAAAATTTAGACGATATAAACGGAGAAAATCAAATGGGCGTAACACAAAGCCAAATTACTGTTTACAACAAAACAAGAATGAGTACCGCTAGAGCGTTCCTTTCGCCAATCCGGAATAGAAACAATTTGCATGTTATCAAAAATACACTGGCTACGAAAATTATATTTAAAGAGAACAGTAATGCCGTTAGTGGAATTATGCTAAACAACAACGGCAAAGAATTTATGGTTAATGTGAACAAAGAGTTGATATTGTCAGCGGGAGCAATTAATTCACCGCACCTTTTAATGTTGTCCGGTATTGGACCTCAAGAACACCTACTTGAACAAAATATTACTGTCAAAATGGATTTAGCGGTTGGAGAAAATCTACAAGATCATGTCTTCGTGCCATTATTGTATACAGCCCCTGCCAAAGAATCTGACGATATTACTATGAGCTTAGTCGTAAACAACTTTTTCGATTACATGGTTAATAAAGAAGGAATACTTTGTGACACCAGTCCGCATAGAATAATTGCATTCGTCAATACCACTGATTCAACTGGTACGAGTCCTGACTTACAATTTCATCACGTTATTTTTACACCTAAAATTCACATTTTACTAGACTTTTTTGAGAAACACGGACTAAATAATGATATTATACAACAATTCCATGAAATTAACAACAATAAGTTCGCTATGTTAATCTACAATACTTTATTGAAACCAAAATCACGAGGAAAAGTATTACTGCAAAGCAATAACCCATTTGATCGTCCATTGATATACGCCAACTATTTCAATGATAATGAAGACATGAAGACGTTAATAAGGGGTATGAGGAAATTTACTTTGAAATTAGGCGAAACAGACGCCTTCAAACAAGTAGGGTTAGAATTAGAATGGTTTCAAATACCAACCTGTGATAAACTTGATAAAACAAGTGACGAATTTTTGGAGTGCATTTCGAGACACTTAACTTTTTCATTGTATCACCCATCGGGCACCGTAAAGATGGGACCAGAAGACGATCCTAGCGCAGTAGTGACTCCTGAGTTAAAAGTTCGAAATATTGAAAATTTGAGAGTAATTGACGCTAGTGTTATGCCTTCCATTGTAAGAGGTAATACTAATGCAGCGACAATCATGATTGGAGAAAAAGGTGCAGAACTAATCAAACAATCCCACATAAAAACAACAGAATAA
Protein
MSACDPTFTSTVIGSYGDVVGTTFAQALTSFLALRRREDAINSVVDGSSYDFVVVGAGSAGSVLANRLSEVPEWKVLLVEAGGNPTVNTEIPQVFYNNLGSKEDWGYRPEPQSGACLSYETKTCAWPSGKTLGGSASINAMFYVRGNHIDFDGWAEDGNNGWSYEDVLPYFKKSENFVADISENDRYHGTKGELYTTKDKNLKPFEEVVLKAYPELGVQNLDDINGENQMGVTQSQITVYNKTRMSTARAFLSPIRNRNNLHVIKNTLATKIIFKENSNAVSGIMLNNNGKEFMVNVNKELILSAGAINSPHLLMLSGIGPQEHLLEQNITVKMDLAVGENLQDHVFVPLLYTAPAKESDDITMSLVVNNFFDYMVNKEGILCDTSPHRIIAFVNTTDSTGTSPDLQFHHVIFTPKIHILLDFFEKHGLNNDIIQQFHEINNNKFAMLIYNTLLKPKSRGKVLLQSNNPFDRPLIYANYFNDNEDMKTLIRGMRKFTLKLGETDAFKQVGLELEWFQIPTCDKLDKTSDEFLECISRHLTFSLYHPSGTVKMGPEDDPSAVVTPELKVRNIENLRVIDASVMPSIVRGNTNAATIMIGEKGAELIKQSHIKTTE

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
BABH01003798    BABH01003799    BABH01003797    JQ965926    AFN71166.1    NWSH01000190    + More
PCG78593.1    ODYU01004023    SOQ43474.1    PCG78592.1    RSAL01000051    RVE50264.1    KQ459595    KPI96023.1    KQ460323    KPJ15963.1    KPI96022.1    JTDY01008426    KOB64574.1    AK402986    BAM19497.1    KQ460890    KPJ10999.1    AJWK01014080    GECZ01027417    JAS42352.1    GECZ01026787    JAS42982.1    GBHO01012330    GBRD01008695    GBRD01008694    JAG31274.1    JAG57126.1    GECU01033045    JAS74661.1    GECU01001143    JAT06564.1    NEVH01020853    PNF21087.1    PNF21103.1    GEBQ01028513    JAT11464.1    GEBQ01016745    JAT23232.1    KQ980881    KYN11981.1    GECZ01013224    JAS56545.1    GECU01004364    JAT03343.1    NEVH01005904    PNF38181.1    GFDF01002039    JAV12045.1    GFDF01002040    JAV12044.1    LBMM01015561    KMQ84762.1    PYGN01000053    PSN56054.1    KQ976532    KYM81564.1    GEDC01024026    GEDC01011147    JAS13272.1    JAS26151.1    GL448571    EFN84147.1    GFDF01002042    JAV12042.1    KK852811    KDR15959.1    ADTU01026683    GFDF01002041    JAV12043.1    CH477290    EAT44639.1    GDIQ01125583    JAL26143.1    KQ981296    KYN43077.1    GGFK01008304    MBW41625.1    GDIP01122942    GDIQ01046714    JAL80772.1    JAN48023.1    GDIP01107288    JAL96426.1    GDIP01189775    GDIP01189774    GDIP01109548    JAJ33628.1    KYN43080.1    UFQT01002442    SSX33469.1    KQ982905    KYQ49514.1    AJVK01026844    AJVK01026845    AJVK01026846    KK107261    EZA53937.1    GDIP01107286    JAL96428.1    GGFK01006105    MBW39426.1    DS235784    EEB16968.1    LRGB01002451    KZS07567.1    GL442298    EFN63615.1    GAPW01000526    JAC13072.1    QOIP01000012    RLU16172.1    KQ982937    KYQ49100.1    GDIP01087847    JAM15868.1    PNF21089.1    GDIP01219777    JAJ03625.1    GDIP01228120    JAI95281.1    GDIP01083296    JAM20419.1    GL888284    EGI63349.1    GDIP01109547    JAL94167.1    GDIQ01223788    JAK27937.1    GDIQ01223789    GDIQ01223787    JAK27936.1    KQ980314    KYN16692.1    GDIQ01126533    JAL25193.1    AAAB01008844    EGK96369.1    GGFK01006251    MBW39572.1    GDIQ01251280    GDIQ01251279    GDIQ01185200    GDIQ01182102    GDIQ01180798    GDIQ01163719    GDIQ01163718    GDIQ01163715    JAK70927.1    GL434548    EFN74792.1    GDIQ01242702    JAK09023.1    GDIP01108083    JAL95631.1    GDIP01228121    GDIP01219927    GDIP01174575    GDIP01158438    JAJ03475.1    KZS07507.1    GDIQ01251278    GDIQ01188299    GDIQ01185202    GDIQ01185201    GDIQ01180799    GDIQ01163717    GDIQ01163716    GDIQ01094633    JAK88009.1    GDIQ01204286    JAK47439.1    GDIQ01162366    GDIQ01111223    JAL40503.1    GDIP01177549    JAJ45853.1    GDIQ01253882    JAJ97842.1    GDIQ01216300    GDIQ01162367    GDIQ01162365    GDIQ01157523    GDIQ01112823    GDIQ01096486    GDIQ01031667    JAL55240.1    GECU01032039    JAS75667.1    GGFK01006898    MBW40219.1    GDIP01216074    JAJ07328.1    GBXI01017045    GBXI01016813    GBXI01008932    JAC97246.1    JAC97478.1    JAD05360.1    GDIP01174531    JAJ48871.1    GDIQ01248185    GDIQ01241251    GDIQ01220935    GDIQ01196405    GDIQ01177948    GDIQ01174041    GDIQ01142131    GDIQ01116533    GDIQ01115331    GDIQ01109424    GDIQ01073988    GDIQ01069503    GDIQ01069502    GDIQ01069501    GDIQ01067900    GDIQ01059899    GDIQ01057405    JAN25236.1    LBMM01005695    KMQ91287.1    GDIQ01082738    JAN11999.1    GDIQ01212735    JAK38990.1    CH916370    EDW00247.1    GDIP01028599    JAM75116.1    GDIQ01222435    GDIQ01222434    GDIQ01220936    GDIQ01220934    GDIQ01220933    GDIQ01212734    GDIQ01204243    GDIQ01186800    GDIQ01186799    GDIQ01183405    GDIQ01183404    GDIQ01183403    GDIQ01155173    GDIQ01152368    GDIQ01123933    GDIQ01067899    GDIQ01066404    GDIQ01063605    JAK68321.1    GDIQ01110931    JAL40795.1   
Pfam
PF05199   GMC_oxred_C        + More
PF00732   GMC_oxred_N
Interpro
IPR036188   FAD/NAD-bd_sf        + More
IPR012132   GMC_OxRdtase       
IPR007867   GMC_OxRtase_C       
IPR000172   GMC_OxRdtase_N       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
4H7U     E-value=3.33725e-49,     Score=494

Ontologies

Topology

Length:
614
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.80161
Exp number, first 60 AAs:
4.7713
Total prob of N-in:
0.20716
outside
1  -  614
 
 

Population Genetic Test Statistics

Pi
265.78805
Theta
215.461299
Tajima's D
0.558225
CLR
0.241958
CSRT
0.538573071346433
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号