SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09584
Pre Gene Modal
BGIBMGA013001
Annotation
PREDICTED:_glucose_dehydrogenase_[FAD?_quinone]_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.445
 

Sequence

CDS
ATGGCGATTTCCACGGTTGCAGCTACAGCCATTAAATCAGCTCTTGCCATCGGCGGTCTGCATACACTTACTTTCATACCGATAATGCTAGCGGCCATGGCCTATTTCAACTATGAACTACTAGATCCCGAACAAAGACCGTTCAATCAGAAATATTTGAGAGAAACATATGATTTCATAGTGGTCGGAGGAGGATCTGCCGGATCTGTATTAGCTAATAGACTGTCTGAAGTTGAAGGTTGGAATGTCTTGCTTTTAGAAGCAGGAGGTCACGAAACCGACATCAGTGATGTTCCCTTACTGTCATTGTATTTGCATAAGAGCAAACTTGACTGGAAATACCGGACCCAACCGCAAGACACTGCTTGCCAAGCTATGATCGACAAACGATGCAGCTGGACTAAAGGCAAAGTCTTGGGAGGCTCTTCAGTTCTCAATACCATGTTGTATATAAGAGGGAACAAGCGTGATTTCGATCAGTGGGAGTCCTTTGGAAACCCGGGGTGGGGCTATGAAGATGTCTTGCCGTATTTCAAGAAATCTGAGGACCAACGCAATCCGTACTTGGCAAAGGATACCAAGTATCATCAAACTGGCGGGTATCTAACTGTCCAAGACTCCCCGTATAATACTCCGATCGGAGCTGCGCTACTCCAAGCTGGTGAGGAAATGGGATATGACTTTATCGACGTAAACGGAGCTCAACAAACTGGATATGCGTGGTACCAGTTTACTATTCGAAGAGGCACCAGATGTTCCACAGCAAAAGCTTTCCTGAGACCTGTAAGACTACGACAGAACCTTCATATCGCTCTATTCTCCCACGTCACTAAAGTTTTAATTGACAAGGATACGAAAAGAGCATACGGAGTCGAATTCCTTAGAGATGGCACTCAGCAAGTCGTTTATGCAAAACGAGAAGTTATATTGGCGGCTGGAGCAATAGCTTCGCCTCAATTACTTATGTTGTCTGGTGTCGGACCCGAGCAACACCTAAAAGAGGTGGGGATCGATGTGATTCATGATTCTCCTGGAGTCGGGAGAAACCTGCAAGATCACATCGCTGTCGGAGGCATTATCTTTCGAATCGATTATCCCGTAAGTTTGGTTATGAATCGTCTTGTGAACATTAACTCTGCTTTACGGTATGCCATCACCGAGGACGGTCCACTTACATCCAGCATCGGCCTCGAAGTTGTAGCTTTTATTAATACTAAATATGCAAATGCTACTGACGATTGGCCTGACATTGAATTTATGATGACATCATGTTCGACGCCTTCTGACGGAGGTACACAAGTGAAAAAAGCACACGGACTGACGGATGAGTTCTACAATGAAGTTTTTCAAGAAGTTAACAACAAAGACGTTTTCGGTATCTTTCCGATGATGTTACGTCCAAAAAGTAGAGGATTTATTAAACTACGCTCTACGAATCCCCTGGACTACCCTATAATGGTCCACAATTACTTGACGCATCCTGATGACGTTGGAGTACTGAGAGAAGGGGTGAAAGCCGCGGTAGCAGTTGGAGAAACAACAGCCATGAAACGTTTCGGATCAAGGTTTCATGCAAAACCTGTCCCGAATTGTAAGCACCTACCTCCTTATACTGACGAATATTGGGACTGTTTTATTCGTCAATACACCATGACCATTTATCACGTTTCGTGTACAGCGAAAATGGGTCCTTCTAGTGACCCAATGGCAGTTGTGGATCCAAGATTAAAAGTATATGGGATCGAAGGTCTTAGAGTGATAGACGCAAGTATTATGCCCACAATTACTAATGGAAATATTAATGCTCCAGTCATCATGATCGCTGAGAAAGGAGCTGATATGATCAAAGAAGATTGGTTACCAAAATCTAAAAAACGACGACGCAGAAGCATCAGATGCTCTAGATTAGAAAAAATTAGTTTAGGCCGTCATAATAGTAAGCTTTGCTCAATTAAAAGATGA
Protein
MAISTVAATAIKSALAIGGLHTLTFIPIMLAAMAYFNYELLDPEQRPFNQKYLRETYDFIVVGGGSAGSVLANRLSEVEGWNVLLLEAGGHETDISDVPLLSLYLHKSKLDWKYRTQPQDTACQAMIDKRCSWTKGKVLGGSSVLNTMLYIRGNKRDFDQWESFGNPGWGYEDVLPYFKKSEDQRNPYLAKDTKYHQTGGYLTVQDSPYNTPIGAALLQAGEEMGYDFIDVNGAQQTGYAWYQFTIRRGTRCSTAKAFLRPVRLRQNLHIALFSHVTKVLIDKDTKRAYGVEFLRDGTQQVVYAKREVILAAGAIASPQLLMLSGVGPEQHLKEVGIDVIHDSPGVGRNLQDHIAVGGIIFRIDYPVSLVMNRLVNINSALRYAITEDGPLTSSIGLEVVAFINTKYANATDDWPDIEFMMTSCSTPSDGGTQVKKAHGLTDEFYNEVFQEVNNKDVFGIFPMMLRPKSRGFIKLRSTNPLDYPIMVHNYLTHPDDVGVLREGVKAAVAVGETTAMKRFGSRFHAKPVPNCKHLPPYTDEYWDCFIRQYTMTIYHVSCTAKMGPSSDPMAVVDPRLKVYGIEGLRVIDASIMPTITNGNINAPVIMIAEKGADMIKEDWLPKSKKRRRRSIRCSRLEKISLGRHNSKLCSIKR

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
BABH01003801    ODYU01000059    SOQ34187.1    NWSH01000190    PCG78591.1    KQ460323    + More
KPJ15965.1    RSAL01000051    RVE50266.1    JTDY01003428    KOB69572.1    KQ459595    KPI96025.1    AGBW02007651    OWR55006.1    KQ978473    KYM93712.1    GL763984    EFZ18946.1    KQ414579    KOC71129.1    AAZX01001588    ADTU01026684    KQ976532    KYM81563.1    NNAY01002337    OXU21519.1    KQ981296    KYN43078.1    KQ980314    KYN16690.1    AAAB01008844    EAA06050.6    AXCN02000040    GL448571    EFN84160.1    JRES01000943    KNC26962.1    CH916370    EDW00250.1    CH940653    EDW62430.1    CH933810    EDW06805.1    KQ435998    KOX67655.1    DS231960    EDS29161.1    GGFJ01002789    MBW51930.1    CH963851    EDW75340.1    GBXI01014029    JAD00263.1    CM000162    EDX01713.1    KRK06314.1    CH902630    EDV38471.1    AY128482    AAM75075.1    CH480847    EDW51054.1    AE014298    BT050468    AAF48400.1    ACJ13175.1    GL441651    EFN64469.1    CH954180    EDV47073.1    KQ759784    OAD62859.1    GDHF01032247    JAI20067.1    KZ288238    PBC31349.1    CP012528    ALC48843.1    CH477290    EAT44640.1    OUUW01000003    SPP78675.1    CH479242    EDW37626.1    CH379063    EAL32576.2    KQ982905    KYQ49513.1    QOIP01000012    RLU16178.1    PYGN01000027    PSN57089.1    ABLF02037931    GFXV01001389    MBW13194.1    KQ971348    EFA05528.1    GGMR01019401    MBY32020.1    GL435626    EFN73009.1    GAMC01000219    JAC06337.1    NEVH01005904    PNF38173.1    GGMS01015954    MBY85157.1    KK107261    EZA53940.1    DS235784    EEB16965.1    CVRI01000064    CRL05333.1    PSN57087.1    GBBI01002388    JAC16324.1    UFQT01000144    SSX20835.1    KB632330    ERL92579.1    APGK01055694    APGK01055695    APGK01055696    APGK01055697    APGK01055698    APGK01055699    APGK01055700    APGK01055701    APGK01055702    APGK01055703    KB741269    ENN71447.1    CCAG010007192    AJWK01012160    AJWK01012161    AJWK01012162    ATLV01017515    KE525172    KFB42231.1    ADMH02002107    ETN58956.1    GBYB01010765    JAG80532.1    GL888284    EGI63347.1    KRT06125.1    KRT06126.1    AXCM01003805    APCN01003121    JXUM01087326    KQ563625    KXJ73585.1    LBMM01003329    KMQ93654.1    ACPB03007739    ACPB03007740    ACPB03007741    PNF38176.1    EEB16963.1    EFN84154.1    GEDC01006623    JAS30675.1    KOC71135.1    ABLF02037922    AAZX01003729    GGMR01016673    MBY29292.1   
Pfam
PF00732   GMC_oxred_N        + More
PF05199   GMC_oxred_C
Interpro
IPR036188   FAD/NAD-bd_sf        + More
IPR012132   GMC_OxRdtase       
IPR007867   GMC_OxRtase_C       
IPR000172   GMC_OxRdtase_N       
IPR027424   Glucose_Oxidase_domain_2       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
5NCC     E-value=4.99695e-64,     Score=622

Ontologies

Topology

Length:
653
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.64235
Exp number, first 60 AAs:
22.55924
Total prob of N-in:
0.99325
POSSIBLE N-term signal
sequence
inside
1  -  12
TMhelix
13  -  35
outside
36  -  653
 
 

Population Genetic Test Statistics

Pi
300.195572
Theta
206.969297
Tajima's D
1.322904
CLR
0.161108
CSRT
0.743612819359032
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号