SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09582
Pre Gene Modal
BGIBMGA013003
Annotation
PREDICTED:_glucose_dehydrogenase_[FAD?_quinone]_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 0.979
 

Sequence

CDS
ATGGGTGTGCACGTTCTTCTAGCGTCCACGGCCTTGAAAACTGTCAGTGTGACCGGATTATGGTTAATACCTCTGTTGCTTGGGGCGCTGACTTATCACAACTATAACTCGTATGATCCGGAATCCAAGGTGCTGGATAAGGAACCGAGGCGAGAGTATGACTTCATAGTGGTCGGGGGAGGATCGGCAGGCGCCGTTGTAGCAAACCGACTGACCGAAGTCTATAATTGGAACGTTCTCTTGTTAGAAAGTGGTCCCGATGAAAACGAAATAACGGACGTCCCTTCGCTAGCAGGGTATCTGCAGCTAACGAAGCTGGACTGGCAGTACAAGACCGAGCCGACGCCATACGCTTGTCTGGGCTTCAAGAAACACAGGTGCAGTTGGCCTAGGGGCAAGGTTCTTGGGGGATCGAGTGTTCTCAACTACATGATATATATTCGTGGAAACAGTCACGATTTCGATCAGTGGGAGTCTTTTGGAAATCCAGGTTGGGGCTATCAAGATGTTCTCAAATACTTCATCAAGTCTGAAGACAACAGGAACCCTTATTTAACTAAGACCAAATATCATGGAACGGGAGGATATCTAACGGTCCAGGAAGCGCCATGGAGAACGCCCTTAGTCGCAGCTTTCGTTGAAGCCGGAGTCGAAATAGGATACGAGAACAGGGACGTTAATGGAGCTATTCAAACTGGATTTATGATAGCCCAAGGAACAATCAGACGGGGTTCGAGGTGTAGCACAGCAAAGGCCTTCTTAAGACCTGTGCGAACACGAAAAAATTTAGACGTATCATTGAATTCGCAAGCAACAAGAGTACTCATAAATCCAGTGACCATGAAAGCGTACGGTGTGGAATTTGTGAAGCACGGTGTAAAAAAAGTTGTATATGCGAGAAAGGAAGTGATCTTATCCGCGGGTGCTATAAATAGTCCCCAACTACTCATGTTATCAGGAATAGGACCGAAAGATCACTTGAGAGATGTGGGTATTAAGGTGATCAAGGATTTACCAGTGGGTGAGAATTTACAAGATCACGTTGGAGTCGGTGGTCTTACATTTCTAGTCGATAAGCCTGTAGCTATAGTTCAGAATCGATTCCAAGCATTTCCTATTTCGATGAATTATGTTGTCAATGAAAGAGGTCCAATGACTACTTTGGGCGGTTTGGAAGGTGTTGCTTTTGTTAACACCAAATACGCAAATAGTTCCGGGCTTTGGCCAGATATACAATTTCATATGGCACCAGCTTCATTTTCGTCTGACAACGGTCAAATCGTGAGAAAAATTCTCGGACTTACCGATGAATTATATGATACAGTATACAAACCTATTGCGAACAAAGATGCCTGGACGATCATGCCCTTACTGCTCCGTCCAAATACACGAGGCTACGTTAGATTAAGGAGTTCGAATCCCTTTCATTATCCAATAATGAATCCTCGATATCACGAAAACGCACTAGATGTTGCGAGACTTGTCGAAGGGATAAAAATCGCTGTAAAAGTCGCAAACGCGTCACCGTTTCGACAATTTGGATCAAGACTTTACAACAAGCCATTGCCAAATTGCAAGCAGTTCCAATTTATGTCTGATGAGTATATAGAATGTCAAGTAAGGACAATTTCGATGACGATATATCATCAGTGTGGGACAGCGAAAATGGGCCCGTCTTGGGACAAAGAGTCAGTTGTCGATCCGAGATTGAGGGTTCACGGTGTTGAAGGACTTAGAGTAATAGATGCAAGTATAATGCCCACTATTGTAAGTGGGAATACAAATGCTGCGGTTATAATGATAGGTGAAAAAGGTTCGGATATGATAAAACAAGATTGGTTGAATAAACGGTGA
Protein
MGVHVLLASTALKTVSVTGLWLIPLLLGALTYHNYNSYDPESKVLDKEPRREYDFIVVGGGSAGAVVANRLTEVYNWNVLLLESGPDENEITDVPSLAGYLQLTKLDWQYKTEPTPYACLGFKKHRCSWPRGKVLGGSSVLNYMIYIRGNSHDFDQWESFGNPGWGYQDVLKYFIKSEDNRNPYLTKTKYHGTGGYLTVQEAPWRTPLVAAFVEAGVEIGYENRDVNGAIQTGFMIAQGTIRRGSRCSTAKAFLRPVRTRKNLDVSLNSQATRVLINPVTMKAYGVEFVKHGVKKVVYARKEVILSAGAINSPQLLMLSGIGPKDHLRDVGIKVIKDLPVGENLQDHVGVGGLTFLVDKPVAIVQNRFQAFPISMNYVVNERGPMTTLGGLEGVAFVNTKYANSSGLWPDIQFHMAPASFSSDNGQIVRKILGLTDELYDTVYKPIANKDAWTIMPLLLRPNTRGYVRLRSSNPFHYPIMNPRYHENALDVARLVEGIKIAVKVANASPFRQFGSRLYNKPLPNCKQFQFMSDEYIECQVRTISMTIYHQCGTAKMGPSWDKESVVDPRLRVHGVEGLRVIDASIMPTIVSGNTNAAVIMIGEKGSDMIKQDWLNKR

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
BABH01003812    ODYU01005276    SOQ45969.1    NWSH01001458    PCG71174.1    KQ458756    + More
KPJ05262.1    KQ460323    KPJ15968.1    AGBW02007651    OWR55009.1    RSAL01000051    RVE50268.1    JTDY01004283    KOB68342.1    CH477290    EAT44642.1    DS231832    EDS31767.1    JXUM01024562    KQ560694    KXJ81238.1    AXCM01008529    ATLV01012990    KE524833    KFB37097.1    AAAB01008844    EAL41335.4    ADMH02002107    ETN58951.1    AXCN02000040    KQ434869    KZC09326.1    GL448571    EFN84162.1    KQ971348    EFA05531.1    GBXI01017045    GBXI01016813    GBXI01008932    JAC97246.1    JAC97478.1    JAD05360.1    KQ435704    KOX80305.1    BT010274    AAQ23592.1    AE014298    BT057975    AAF48398.1    ACM16685.1    CP012528    ALC48845.1    CH940653    EDW62433.2    CH933810    EDW06808.2    CM000162    EDX01711.1    GAKP01015844    JAC43108.1    CH954180    EDV47075.1    GAMC01020243    JAB86312.1    CH916370    EDW00247.1    GL888284    EGI63349.1    KQ981296    KYN43080.1    NNAY01000267    OXU29610.1    AAZX01008029    KQ414579    KOC71127.1    KZ288238    PBC31347.1    CCAG010013550    KQ980314    KYN16692.1    OUUW01000003    SPP78678.1    ADTU01026685    CH963851    EDW75338.1    GL763984    EFZ18935.1    CH379063    EAL32573.3    QOIP01000012    RLU16172.1    PYGN01000027    PSN57124.1    LBMM01005695    KMQ91287.1    KK107261    EZA53937.1    APCN01003123    APCN01003124    DS235784    EEB16963.1    KQ759784    OAD62856.1    GBYB01002620    JAG72387.1    KY618825    AQW43011.1    NEVH01022362    PNF18877.1    APGK01055703    APGK01055704    KB741269    ENN71448.1    GL442298    EFN63615.1    AJVK01026328    GEDC01024026    GEDC01011147    JAS13272.1    JAS26151.1    KK852802    KDR16286.1    CVRI01000064    CRL05333.1    KB632330    ERL92578.1    GFTR01007495    JAW08931.1    ACPB03007733    ACPB03007734    ACPB03007735    ACPB03007736    KQ982905    KYQ49512.1    ABLF02037928    GFXV01007441    MBW19246.1    EAA45201.5    GBXI01010590    GBXI01000279    JAD03702.1    JAD14013.1    AXCM01006544    GEDC01006623    JAS30675.1    ATLV01017501    KE525172    KFB42226.1    EGK96364.1    JRES01000943    KNC26963.1    GAKP01019984    GAKP01019981    GAKP01019978    GAKP01019975    JAC38968.1    BABH01003807   
Pfam
PF05199   GMC_oxred_C        + More
PF00732   GMC_oxred_N
Interpro
IPR036188   FAD/NAD-bd_sf        + More
IPR012132   GMC_OxRdtase       
IPR007867   GMC_OxRtase_C       
IPR000172   GMC_OxRdtase_N       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
5OC1     E-value=1.11245e-60,     Score=593

Ontologies

Topology

Length:
617
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
14.8214499999999
Exp number, first 60 AAs:
13.17873
Total prob of N-in:
0.46844
POSSIBLE N-term signal
sequence
outside
1  -  617
 
 

Population Genetic Test Statistics

Pi
298.384976
Theta
176.281982
Tajima's D
2.341349
CLR
0.27495
CSRT
0.932053397330133
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号