SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09580
Pre Gene Modal
BGIBMGA009215
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.054
 

Sequence

CDS
ATGCGACACCATCAAACCAAAAAGCAAGTCGAGGGACCGTGGACGCCGGCTGCTAGAATAAGTCACACGAAAGAGCAATCTGCAAAAGATAATATTATGAAATATAATAAATCTAGAGGCAATAAAACCGTGGCGTCGCGGGACGCGAACCAAGCGTCACGTGATAACATAATTCCCAACTGGGGTTCACAAAGCGCGGGAATTCGATCGCAGCCAAAACCAAACCAAGAACATCGACCACGAGTAGAACCGAAGCCGACCGCCATACTAACAAGTAACATGTTTTCACCGCTTGCTTTTGATGAGGAAGAACGAGATAGGGAATCTGACGATACCGTCTCAGTATTGAGTGAGGGTGGGGGCACCAAGCGACGACGTGTTCATAAGACACGGGCGGCATCTATTGGTGTCTCACCAGCGTATCTCCCTTTTGACAACATGGGACAAAGCAGTGCTCCAAATGGATCAAATAAAAATTTTACGAAGGATACAAGAACAAAGCGATATCCTCCATTTATATGTGAATATGACGCATGGATCACGGATAAAAACGAGTGGAAGGCGGCGAATGAAATTGCTCGAGTGAGTAATTGTGAAATACGCGCTAATCCAAAGAGCAAGAAAATAACATTTATTCCAAAAAACAAGGAAGCTTATGAAGCCATACAGAGGCGACTAAATGAAAACCCAGACAAATATAATTACTACACATACGGATGCAAAGACGATCATCGCCCGGCAAAGAAGCTAATAGCTAAAGGGGTCCGCGTCGAAGGTTACACAGAGGAAGAAATCAATGCCGATATTCTTGCAAGATATGGAATCAAGATGGAACGGGTAATTATTATGAAAAATTCAGCGTTGATTCTCATCTTCCCAAGTGAAACTGACATGCGAGTAGCCCGCGATATAAAGTTTATCTTAAGTCAGCGTGCTACAATCGAGAAATACAAGGTACGAGACACCGCGGTGACACAATGCAAGCGGTGCTGGCAATTTGGTCATGTGCAATCTCATTGCCGGCGTCCAGAGCAACCAGACTCTGTTGAACAACGCGAAGATGGAGATGTGTGGCATGTGTGCTACAACTGTCACGAAATTGGTCATACAGCAAGACAGGCAAAGTGCCCGCTATTCCAGTTAGAAATAAAAAAACAGAAAAACAGGCGACAGGCTTTCGTCAAAAATAATGAAGGACTTACACTACCCACAAAACGTATGATAGAAGCTTCGAATATAAAAGCAGCCCCAGCCACACGGGTCGACAGAACTAGCTATGCAGCAGCAGCAGGTGCCTTAAGTAGCCCTAAAACCACACGCAAGCCCCCTGAGAATGAATCCAAGGCAAAGGCGTTACCTGACTTACTCAGCAAAGCAAAAGAGTTGATGAAAAGCGTGGATGACGTTGATCGTCGTATTGAGGGAGTAGCTATCAGGCTAGAAACAATTGACGGTGGTATCATCGTGCGAGGGTTGTATAATCCACACTTACGTTTCTATCAAATTCGGGCGGACTGGGAAGCTCTCTTGGACACTCAAACACAAGCCGCAGGTGCGCTGGTGCAGCTGGCCATTGGCAACAGAGAGGCAAAATTGGTGCATACTGGCTTACCATCTCGACCCTGCCATCAAGGAAACGGTATACTCGATGTCGCACTGGTGACACAAGAGGCCATGGAGTACACTTATCGAACGAAGCAACTCGATTCTATCTCGTCAGATCACTATCCGTGGCAATTGGAAGTTGATATAGAGGTGCACGAACATGTGCTACTGAGGCGAAAGATGAACAGCATTACTGAATCTAAGGAGTCTCGCATCAAATTCCAAGAGCTAGTCGAAGCAAATCTTCCAGTAATTGTGCCAACCACTGATGCTGAGGCAGATTCATGCGTCGATAACTTGGAAAATGTACTCACTGCGGCATTAGATGAGATGGCGCCGCTACGAGAGTTAATACGACGGGAGGAACTACCAATAAACATCCAATACATGATACAACATCGCAACCGAAGCAAACTAAAAGCAAAAAATGCACCAAGAGGACATATTCTCCGTCGGACATACAACGCTGCAAAGACCATACTGAAGCAAGCGCTGCAAGAATATCGAGAGACCCAATGGAACAACGTCATTGATAGTCCTGAAAACAACAATGCTAAGATGTGGACTATTCAACGCTCTCTGAAGATCAAGCCTCAGCGTCTACCTGATCTACATGGAGTTGTAACTGAAGAAGAAACAATCAATACTCTGGTTGACACGGCAATAGTAAAAGAAGCAAATGTGGATGACACTCATAAAAATTCTGAGACCTTTACCCCATACCAACCGCTGGCCGAGACCGACGTAGACGAGGTAATACGAGCTCTTCGCTTCTTCAAGAACAAGAAAGCGCCAGGCCCCGATCAACTAAGGGCTGACGCAATAAAACTTGCTGGCCCAGCATATTATACCGCACTGACAAACACAATAAACTACACTCTACGCACAGGATATTATCCAAGCCGATGGAAGCTGGGTGACTGTATCTTCTTACACAAACCAGGCAAACCACATACCGAAGCTGCCTCGTATCGTCCCATTATGTTACTTAACATTATGGGTAAGCTGTGCGAACGAGTTATGTATAGCAGAGTTCTCTCAGAAGTGAACCGTTTGCATCTTATCCCAGAATACCAGCACGGTTTTACAAAAAATAAAGGGACTGGTACCCAAATTTTACGAACTGGTAAGGTTATTACAGACGCTTTGGCAGAGGGCAACAGTGTAGCGATGATTTCTACTGATCTCAGTAAAGCTTTCGATTCCATAAATCATGCAGGGCTAAGCAAGAAACTGTTTAACGCTGGAATGGCAAATAATGTAATTAAGCTAATAGAGAATTACCTGAAAAATCGGGAGGCTCGTGGTAAGTACCGAACAATGTATGGAAAAAGGCAACTGATTCCGCACGGAGTACCACAGGGCTCAATTTTGGGGCCGATCCTCTTCAACTTATACATGAGTGATATCCCCAAGACCCACATCGCAGGTATCACACTCTCACAGTATGCTGATGATCTATGCATCCTGAATGAGGCTAGCCAACCAGATACAGCATCGCGGAGAGCGGCATGGGCTGCTGAGACAATTATAAACTACTACAAGGAATGGGGTCTGCAGTGCAATGTGAGCAAAACGGATTGCATAATGTTTACAAATAAACGCAAATTTAATCGCACCATACAACTTCAACATGAGGCATTACCAATAAAAAGTAACATAAAATATCTTGGAGTGCATCTCGACCAAAGATTAGTGATGAAGGAACATGTAAAAAACACAGTGAAAAAAGTAAAACAAGTGCGTGGAATGCTAGCGCCTATCATAGGATGGTATAGTAAAGTGTCCCTTGAAACAAAACTTAAAGTGATCAAAGCAACTGTTCTACCAATCATTGATTACGGCATTGTACAACTATACCCTAGGGTATGTAAGTCTAAGCTAACTGAATTAGAGAGGCAATATCGAATGGCATTGAAGACAGCGGGTAACTTTCCTCGCAATACGAGTTCAGAAGTAATCTGGGAAATGCTTGATGAGGATCCGTGGTACATACGTGCCAGGGACCTTCATGAAGATATGCTCCGCAAGTTAAAAGATCAGCAAATCCCTGGACTTACACTCCCTGGGAATAAATATGATAAACTGAACCACCATAATCCTATGTTGCCTAGCCTGCGCGCAGGTGAAATCGATTATGTTGACAAAAAAGAAAGAGGCAAACCGCTCTCCAAGCGAACGGTTCCTCCTCGTATTCCTATCCTTTAG
Protein
MRHHQTKKQVEGPWTPAARISHTKEQSAKDNIMKYNKSRGNKTVASRDANQASRDNIIPNWGSQSAGIRSQPKPNQEHRPRVEPKPTAILTSNMFSPLAFDEEERDRESDDTVSVLSEGGGTKRRRVHKTRAASIGVSPAYLPFDNMGQSSAPNGSNKNFTKDTRTKRYPPFICEYDAWITDKNEWKAANEIARVSNCEIRANPKSKKITFIPKNKEAYEAIQRRLNENPDKYNYYTYGCKDDHRPAKKLIAKGVRVEGYTEEEINADILARYGIKMERVIIMKNSALILIFPSETDMRVARDIKFILSQRATIEKYKVRDTAVTQCKRCWQFGHVQSHCRRPEQPDSVEQREDGDVWHVCYNCHEIGHTARQAKCPLFQLEIKKQKNRRQAFVKNNEGLTLPTKRMIEASNIKAAPATRVDRTSYAAAAGALSSPKTTRKPPENESKAKALPDLLSKAKELMKSVDDVDRRIEGVAIRLETIDGGIIVRGLYNPHLRFYQIRADWEALLDTQTQAAGALVQLAIGNREAKLVHTGLPSRPCHQGNGILDVALVTQEAMEYTYRTKQLDSISSDHYPWQLEVDIEVHEHVLLRRKMNSITESKESRIKFQELVEANLPVIVPTTDAEADSCVDNLENVLTAALDEMAPLRELIRREELPINIQYMIQHRNRSKLKAKNAPRGHILRRTYNAAKTILKQALQEYRETQWNNVIDSPENNNAKMWTIQRSLKIKPQRLPDLHGVVTEEETINTLVDTAIVKEANVDDTHKNSETFTPYQPLAETDVDEVIRALRFFKNKKAPGPDQLRADAIKLAGPAYYTALTNTINYTLRTGYYPSRWKLGDCIFLHKPGKPHTEAASYRPIMLLNIMGKLCERVMYSRVLSEVNRLHLIPEYQHGFTKNKGTGTQILRTGKVITDALAEGNSVAMISTDLSKAFDSINHAGLSKKLFNAGMANNVIKLIENYLKNREARGKYRTMYGKRQLIPHGVPQGSILGPILFNLYMSDIPKTHIAGITLSQYADDLCILNEASQPDTASRRAAWAAETIINYYKEWGLQCNVSKTDCIMFTNKRKFNRTIQLQHEALPIKSNIKYLGVHLDQRLVMKEHVKNTVKKVKQVRGMLAPIIGWYSKVSLETKLKVIKATVLPIIDYGIVQLYPRVCKSKLTELERQYRMALKTAGNFPRNTSSEVIWEMLDEDPWYIRARDLHEDMLRKLKDQQIPGLTLPGNKYDKLNHHNPMLPSLRAGEIDYVDKKERGKPLSKRTVPPRIPIL

Summary

Pfam
PF07530   PRE_C2HC        + More
PF14529   Exo_endo_phos_2
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000350941,     Score=109

Ontologies

Topology

Length:
1270
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0604300000000002
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00220
outside
1  -  1270
 
 

Population Genetic Test Statistics

Pi
353.552304
Theta
181.630616
Tajima's D
2.609015
CLR
0
CSRT
0.953952302384881
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号