SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09577  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013006
Annotation
Glucose_dehydrogenase_[acceptor]_[Papilio_machaon]
Location in the cell
Cytoplasmic   Reliability : 1.195
 

Sequence

CDS
ATGTTACTGAATTATATTTCATTTTTAAGTGTTTTAATTAGCACTACAGCGTTTCATGACTACGAGTATGGCGATGATTACGAACACGATAGTGATCAATTTCGTGAACAGGGTAGATCGTATCCACAGAGTCCGATCATTGACGCAGTTTTGAAATCATACGCTCCTAATTACGTGCCGAAAAATTCTGAAGACATTTTTGATTTTTTGAGAGATTCATACCCACTGCCCGCAGGTCTTCAGAGTCCCTATGATGAATATGACTTCATTATCGTAGGGGCGGGCTCAGCAGGCTCTGTTTTAGCTTCTAGACTAACAGAAGATAAGAACACCACGGTCTTGCTTATAGAGGCCGGGAAGCCAGAAATGATATTAACTGACATTCCAATTATGGCACCATATTTTCAATCAACAGAATATGCCTGGCAGTACTATATGGAACCCCAACCTGGAGTTTGTACGGGCATGATCAACGGTCGTTGTTTTTGGCCGCGCGGGAAGGCTGTCGGGGGTAGCAGCGTCATCAACTACATGATATACACGCGTGGTAGACCACAAGAATGGGACAGAATCGCGGCTGCGGGGAATTATGGATGGTCCTATAGCGATGTTTTGGAATACTACAAAAAAGGCGAGAGAGCTAATCTAAACGGCTATGAAAAAGATCCAACGAGAAATCGCAACGGAGAAATGCCCGTTGAATTTGCACGATACAGAACCAAACTTATCGAAGCATTTTTGGAAGCGGGCAGAATCCTTGGACATCCAACAATCGATTATAATTCACCGCACCAATTAGGATTCGGTTATGTGCAAACTACAATAACCAAAGGACACCGACAAACTGCTGCGAAAGTATTTCTGCATAGACAGAAAACACGGCAAAACTTACACATCTTGCCGGACACATACGTCACTAAAATACTGATAAATCCTCAAACTAAAACCGCTTACGGAGTCGAATACGTACGCAACCGATTAAAACATAGTGTACTAGCACGTAAAGAAGTAATTCTATCTGCTGGTCCCATAGCATCCCCCCAGCTACTTATGTTATCCGGCGTGGGCCCCAAAGAACATTTAACTTCAATGGGTATACCAGTTCTCAAAGATCTGCCAGTTGGAAAAACGCTTTACGATCATATTTCTTTCCCCGCTCTTATATTCGAACTCAACACAACCGACGTCAGTTTGAACGAAAACAAGATGCTAAATGCTAAATCTGCAATTGAGTGGATTAAAAATGGTGACAATGTTATGTCATCTCCAGGGGGCGTGGAAGGAATTGGTTATATCAAAACTCCGGTCTCTAACGATCTGGATCCTATACCAGACATCGAACTGCTCAGCATTGGGGGATATATACTTGTCGATGGTGGGCCTGGAGGTAGCAAAGCGGTAAGAAAAGGAATGAGAATTAGGGATGCAGTTATAGATGAGGCTTTTGGATCAATAGACAGAATCTCTAAAGATACATGGAGTGCTTTTCCCATGTTACTACACCCAGTTTCCTTTGGAAGAATCGAACTTAAGAATAAAAATCCATTTAGTCACCCACGGATGTATGGAAATTATTTAACTCACCCAAAAGACGTGGCAACCTTCATAGCTGCAATACGTCATGTACAGGCTTTAGTTGCTACACCGCCTTTTCAGAAACTTGGTGCAAAAATACATAAAGCTCCCTACCCAACTTGCCGTGACATACCGTTTGACTCAGATGAGTACTGGGAATGCGCTATTCGCACCCTCACTGCTACTTTGCACCACCAGATTGCGACATGTCGAATGGGACCAAACAATGATTCATTAGCAGTTGTAGACCCAGAACTAAGAGTATATGGGATCGAAAAACTGCGGGTCGTAGATTCAGGAGTCATACCACGAACTATATCTGCTCATACAAATGCACCCGCGATGATGATCGCCGAAAAAGCTGCTGATATGATCAAGGCTACATGGACACATCCTTGA
Protein
MLLNYISFLSVLISTTAFHDYEYGDDYEHDSDQFREQGRSYPQSPIIDAVLKSYAPNYVPKNSEDIFDFLRDSYPLPAGLQSPYDEYDFIIVGAGSAGSVLASRLTEDKNTTVLLIEAGKPEMILTDIPIMAPYFQSTEYAWQYYMEPQPGVCTGMINGRCFWPRGKAVGGSSVINYMIYTRGRPQEWDRIAAAGNYGWSYSDVLEYYKKGERANLNGYEKDPTRNRNGEMPVEFARYRTKLIEAFLEAGRILGHPTIDYNSPHQLGFGYVQTTITKGHRQTAAKVFLHRQKTRQNLHILPDTYVTKILINPQTKTAYGVEYVRNRLKHSVLARKEVILSAGPIASPQLLMLSGVGPKEHLTSMGIPVLKDLPVGKTLYDHISFPALIFELNTTDVSLNENKMLNAKSAIEWIKNGDNVMSSPGGVEGIGYIKTPVSNDLDPIPDIELLSIGGYILVDGGPGGSKAVRKGMRIRDAVIDEAFGSIDRISKDTWSAFPMLLHPVSFGRIELKNKNPFSHPRMYGNYLTHPKDVATFIAAIRHVQALVATPPFQKLGAKIHKAPYPTCRDIPFDSDEYWECAIRTLTATLHHQIATCRMGPNNDSLAVVDPELRVYGIEKLRVVDSGVIPRTISAHTNAPAMMIAEKAADMIKATWTHP

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
BABH01003829    BABH01003830    BABH01003831    ODYU01006526    SOQ48459.1    RSAL01000051    + More
RVE50271.1    KQ460323    KPJ15970.1    KQ458756    KPJ05260.1    RVE50270.1    NWSH01001458    PCG71170.1    AGBW02007651    OWR55011.1    RSAL01000001    RVE55122.1    AGBW02014789    OWR41062.1    KZ149911    PZC78108.1    KQ460883    KPJ11152.1    KQ459603    KPI92808.1    KPJ05259.1    OWR55012.1    KPJ15971.1    JTDY01004843    KOB67682.1    BABH01003834    JTDY01001201    KOB74558.1    AK402758    BAM19368.1    ODYU01002091    SOQ39165.1    CVRI01000064    CRL05333.1    ODYU01000745    SOQ35996.1    UFQS01000369    UFQT01000369    SSX03245.1    SSX23611.1    SSX03246.1    SSX23612.1    AJVK01032026    GL436992    EFN71295.1    GL763984    EFZ18940.1    KQ971348    KYB26873.1    GBYB01004178    JAG73945.1    CH477290    EAT44646.1    CVRI01000019    CRK90469.1    LBMM01006334    KMQ90686.1    CH964272    EDW85092.1    GFXV01004112    MBW15917.1    ABLF02037922    KK853018    KDR12457.1    AE014297    AAF56574.1    GGMR01016673    MBY29292.1    EAT44645.1    GEDC01006623    JAS30675.1    JXUM01024565    KQ560694    KXJ81242.1    GGMS01001005    MBY70208.1    HQ857158    AEM60160.1    CM000160    EDW98646.1    CM000364    EDX14533.1    CH933806    EDW15219.1    KRG01446.1    HQ245150    AEB91339.1    HQ245152    AEB91341.1    AAZX01003729    JXUM01027342    KQ560787    KXJ80883.1    JXUM01024564    KXJ81241.1    CH902617    EDV42950.1    KQ434869    KZC09314.1    EFA05534.2    HQ857156    AEM60158.1    NEVH01021235    PNF19690.1    CH479182    EDW33983.1    KQ759784    OAD62863.1    GL888284    EGI63351.1    GAPU01000071    JAB84774.1    DS235784    EEB16961.1    CH940650    EDW67016.1    KRF83055.1    KQ978473    KYM93709.1    NEVH01013984    PNF27957.1    KZC09328.1    CM000070    EAL28302.2    KRT00640.1    QOIP01000012    RLU15835.1    CH954182    EDV53564.1    CH916369    EDV93702.1    JXUM01102122    JXUM01102123    JXUM01102124    JXUM01102125    KQ564702    KXJ71872.1    GBYB01007495    JAG77262.1    GBXI01003797    JAD10495.1    KQ976532    KYM81560.1    EEB16960.1    JXUM01056073    JXUM01056074    KQ561895    KXJ77234.1    ADTU01026685    RLU16174.1    OUUW01000023    SPP89560.1    KQ414579    KOC71135.1    CH940653    EDW62437.2    HQ857157    AEM60159.1    GDHF01030739    JAI21575.1    GECU01009357    JAS98349.1    NNAY01000314    OXU29282.1    KXJ81243.1    CH477801    EAT36071.1   
Pfam
PF00732   GMC_oxred_N        + More
PF05199   GMC_oxred_C
PF17906   HTH_48
Interpro
IPR036188   FAD/NAD-bd_sf        + More
IPR007867   GMC_OxRtase_C       
IPR000172   GMC_OxRdtase_N       
IPR012132   GMC_OxRdtase       
IPR041426   Mos1_HTH       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
5OC1     E-value=1.32784e-56,     Score=558

Ontologies

Topology

SignalP
Position:   1 - 17,         Likelihood:  0.692933
 
 
Length:
657
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0621600000000002
Exp number, first 60 AAs:
0.05799
Total prob of N-in:
0.00317
outside
1  -  657
 
 

Population Genetic Test Statistics

Pi
23.568863
Theta
203.661888
Tajima's D
0.355249
CLR
0.615526
CSRT
0.472876356182191
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
29197581 IQDIGVENTEENR 100.00 4e-06
25860555 KDEVPSAR 100.00 6e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号