SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09575  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013007
Annotation
PREDICTED:_glucose_dehydrogenase_[FAD?_quinone]-like_isoform_X1_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 3.316
 

Sequence

CDS
ATGCAATTGACAGTAAATTTACTCAATGGTTATGAAAAAGATCCAACAAGGAATCGTAATGGGGAAAACCCTGTGGAATTTGTACCGATCAGGACTAAGCTCATCAAAGCATTTTTAGAGGCCGGTAGAATCTTTGGACATCCAACAATTGATTACAATTCACCGCACCAATTAGGATTCGGTTATGTGCAAGCTATAACAACCAAAGGACACCGACAAAGTGCTGCGAAAGTATTCCTGCATAGACAGAAGAAGCGACAAAACTTACACATCTTGCCGGACACATACGTCACTAAAATACTCATAGATGCTCGAACTAAGACAGCCTATGGAGTCGAATACGTACGAAACAGATTAAAACACACTGTACTAGCACGAAAAGAAGTAATTCTATCAGCCGGTCCCATAGCGTCTCCTCAGCTACTTATGTTATCCGGCGTGGGGCCTAAAAAACACTTAAATTCAATGGGCATACCGGTTCTCAAAGATCTGCCAGTTGGTAAAATGCTATACGATCATATTTGTTTCCCGGGACTTATATTTGAACTCAACACAACCGATGTCAGCTTGCACGAAAGCAAAATGTTAAGAGTGCGACCTATACTGCAGTGGTTAAAGAATGGTGATAGTACACTATCATCTCCGGGTGGCGTGGAAGGAATCGGTTATATCAAAACTCCGATCTCCAACGATCCAGATCCTATACCCGATATTGAACTAATCAGTATCGGTGGATCTATACTGTCAGATGGTGGGCCTGGAGGCAGTAGAGCAATTCGAAGAGGAATGAGAATTAGGGATGCAGTTATAGATGAGGCTTTTGGATCAATAGATAGAGTCGCAAGAGATACTTGGAGTGCTTTTATTTTGTTGCTACACCCAGTTTCATTTGGGGGAATAGAGCTTAAAAATAAAAACCCATTTAGTCATCCCCGGATGTATGGAAATTATTTAACTCATTCGAAGGATGTAGTAACAATTATTGCTGGGATACGATACGTACAGGCTATGGCGGCAACATTCCCTTTCCAGAAGTTTGGTGCAAAAGTACACAAAGCGTCCTATCCAACTTGCCGACACATACCGTTTGATTCAGATGAGTACTGGGAATGCGCTATTCGCACCCTCACTGCTACTTTGCACCACCAGATTGCGACGTGTCGAATGGGACCAAACAATGATCCATTAGCAGTTGTAGACCCAGAACTAAGAGTATATGGGATCGAAAAACTGCGGGTCGTAGATTCAGGAGTCATACCACGAACTATATCTGCTCATACACATGCACCCACGATGATGATCGCTGAAAAAGCTGCTGATATGATCAAAGCTACATGGGCATCAATGCTACCTAATTACATTTCCTATTCATAA
Protein
MQLTVNLLNGYEKDPTRNRNGENPVEFVPIRTKLIKAFLEAGRIFGHPTIDYNSPHQLGFGYVQAITTKGHRQSAAKVFLHRQKKRQNLHILPDTYVTKILIDARTKTAYGVEYVRNRLKHTVLARKEVILSAGPIASPQLLMLSGVGPKKHLNSMGIPVLKDLPVGKMLYDHICFPGLIFELNTTDVSLHESKMLRVRPILQWLKNGDSTLSSPGGVEGIGYIKTPISNDPDPIPDIELISIGGSILSDGGPGGSRAIRRGMRIRDAVIDEAFGSIDRVARDTWSAFILLLHPVSFGGIELKNKNPFSHPRMYGNYLTHSKDVVTIIAGIRYVQAMAATFPFQKFGAKVHKASYPTCRHIPFDSDEYWECAIRTLTATLHHQIATCRMGPNNDPLAVVDPELRVYGIEKLRVVDSGVIPRTISAHTHAPTMMIAEKAADMIKATWASMLPNYISYS

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
BABH01003831    BABH01003829    BABH01003830    ODYU01006526    SOQ48459.1    KQ460323    + More
KPJ15970.1    KQ458756    KPJ05260.1    RSAL01000051    RVE50271.1    NWSH01001458    PCG71170.1    RVE50270.1    AGBW02007651    OWR55011.1    JTDY01001201    KOB74558.1    RSAL01000001    RVE55122.1    JTDY01004843    KOB67682.1    KZ149911    PZC78108.1    AGBW02014789    OWR41062.1    AK402758    BAM19368.1    KPJ05259.1    OWR55012.1    KPJ15971.1    KQ459603    KPI92808.1    KQ460883    KPJ11152.1    ODYU01002091    SOQ39165.1    BABH01003834    JTDY01000138    KOB78646.1    AJVK01032026    CVRI01000064    CRL05333.1    JXUM01024564    KQ560694    KXJ81241.1    KQ971348    EFA05534.2    CH477290    EAT44645.1    HQ857158    AEM60160.1    UFQS01000369    UFQT01000369    SSX03246.1    SSX23612.1    SSX03245.1    SSX23611.1    APCN01003125    AAAB01008844    EAA45200.5    GL436992    EFN71295.1    NEVH01013984    PNF27957.1    HQ245146    AEB91347.1    KK853018    KDR12457.1    AXCM01002814    DS235131    EEB12342.1    KQ435703    KOX80330.1    KYB26873.1    EAT44646.1    KQ434869    KZC09314.1    ATLV01012991    KE524833    KFB37100.1    CVRI01000019    CRK90469.1    GBHO01043105    JAG00499.1    QOIP01000012    RLU15835.1    HQ857157    AEM60159.1    CH963851    EDW75334.1    JXUM01024565    KXJ81242.1    KZ288238    PBC31353.1    ADTU01026680    HQ857156    AEM60158.1    KQ759784    OAD62863.1    CH916370    EDW00244.1    CH379063    EAL32571.3    KQ976532    KYM81568.1    GGMS01001005    MBY70208.1    JXUM01027342    KQ560787    KXJ80883.1    KQ979701    KYN19666.1    KQ981281    KYN43299.1    KQ414579    KOC71135.1    AXCM01005241    ADMH02002030    ETN59864.1    CH940653    EDW62437.2    GL448571    EFN84154.1    CH479182    EDW33983.1    GL434548    EFN74792.1    OUUW01000003    SPP78683.1    APCN01000325    HQ245144    AEB91345.1    NNAY01004263    OXU18129.1    CM000364    EDX14533.1    ODYU01000745    SOQ35996.1    CM000070    EAL28302.2    KRT00640.1    GL888048    EGI68822.1    AAAB01008859    EAA07534.5    JTDY01003720    KOB69096.1    CH479242    EDW37633.1   
Pfam
PF05199   GMC_oxred_C        + More
PF00732   GMC_oxred_N
Interpro
IPR036188   FAD/NAD-bd_sf        + More
IPR000172   GMC_OxRdtase_N       
IPR007867   GMC_OxRtase_C       
IPR012132   GMC_OxRdtase       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
5NCC     E-value=2.08957e-31,     Score=339

Ontologies

Topology

Length:
457
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0839999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00335
outside
1  -  457
 
 

Population Genetic Test Statistics

Pi
188.762321
Theta
207.217883
Tajima's D
-0.693465
CLR
1.286834
CSRT
0.199890005499725
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
29197581 IQDIGVENTEENR 100.00 2e-05
25860555 KDEVPSAR 100.00 4e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号