SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09573
Pre Gene Modal
BGIBMGA013009
Annotation
hypothetical_protein_KGM_15613_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 2.978
 

Sequence

CDS
ATGAAGTCGGAACGAGCCTATCTTAAAGGACTTGCCGATTCACCTTGGCATGGTCGCGACGGGGAGCTTAATGTTGAATATGTACCGTTCAAATCCAAGTTATCGAAGGCCTTTCTCGACGCCGCCAAATTATTTGGCCATCGTAGAGTCGATTATAACAGTCCCGATGCGTTCGGATTCAGCTACATCCAAGCGACTATGAGTCACGGTCACAGAACCAGCAGTGCGAAAGCCTTTTTACACGACCACAAAAAGAGAAAAAATCTTCACATTTTAAATAGTAGCACCGTCACAAAGATATTGATAGATCCTTTATCCAAAACCGCAACGGGTGTTGAGTTTCATCGCAATGGAAGGGTGTACCAAATAAATGCCAAGAAAGAAGTAATATTATCAGCAGGACCAATCGAGTCTCCGCATTTGCTGATGTTGTCTGGTATTGGTCCAAAAGACCATCTCAATTCCTTTGGGATACCGGTTATCCAAGATTTAAAAGTGGGAGAGTCTCTGTACGATCACATTTCGTATCCTGGTCTTGCTTTTACGATTAACACTACAAAACTAACGTTGGTGGAGCGTAAAATAGCAACAATAGATAATGTCTTACAGTTAGAACAATATGGAGATGGACCAATGTCTTCACTTGCGGGTGTAGAAACTATAGGTTATATCAAAACGAACATTTCTAAAGAACCAGGAGACTATCCTGATATAGAGTTGTTGGGTTCTTGTGCTTCGCTAGCTTCGGATGAGGGCGATGTTGTTGCGAAAGGAATCCACCTGGCTGATTGGCTTTATCAAGACATTTATCGACCCATCGAAAATGTTGAAAGTTTTACTGTTTTATTTATGCTCTTGCACCCAAAATCAAAAGGTCATTTAAAGTTACGTTCAACGAATCCTTTTGACCATCCCAAGTTGTACGGGAATTACATGATTCATCCAGATGACACGGCGACTATGGTAGAAGCGATTAAATACATTATAAAGCTGGTCGACACTTCGCCTTTCCACAAATACGGAGCAAAATTATACACAAAGCCTCTCTCGACATGTAAACATTATCAATTTGGAAGCGATAAATATTGGGAGTGTGCGGTGAGGACAATCACGTCTACGTTACATCATCAGATTGCAACATGTAAGATGGGACCATCATCAGATCCTGAAGCCGTCGTAGATCCCGAATTGAAAGTGCACGGCGTAAATAATCTTAGAGTTGTCGATAGTAGCATTATACCAAAGCCAATTTCGGCCCATACGAATGCTCCAGCAATCATGATAGGGGAAAAAGCTGCGGCTTTGATTAAAAAATCGTGGAAGCTTTTGTGA
Protein
MKSERAYLKGLADSPWHGRDGELNVEYVPFKSKLSKAFLDAAKLFGHRRVDYNSPDAFGFSYIQATMSHGHRTSSAKAFLHDHKKRKNLHILNSSTVTKILIDPLSKTATGVEFHRNGRVYQINAKKEVILSAGPIESPHLLMLSGIGPKDHLNSFGIPVIQDLKVGESLYDHISYPGLAFTINTTKLTLVERKIATIDNVLQLEQYGDGPMSSLAGVETIGYIKTNISKEPGDYPDIELLGSCASLASDEGDVVAKGIHLADWLYQDIYRPIENVESFTVLFMLLHPKSKGHLKLRSTNPFDHPKLYGNYMIHPDDTATMVEAIKYIIKLVDTSPFHKYGAKLYTKPLSTCKHYQFGSDKYWECAVRTITSTLHHQIATCKMGPSSDPEAVVDPELKVHGVNNLRVVDSSIIPKPISAHTNAPAIMIGEKAAALIKKSWKLL

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
BABH01003834    ODYU01002091    SOQ39165.1    AGBW02007651    OWR55012.1    KQ458756    + More
KPJ05259.1    KQ460323    KPJ15971.1    JTDY01000138    KOB78646.1    KPJ05260.1    RSAL01000051    RVE50270.1    KPJ15970.1    RVE50271.1    RSAL01000001    RVE55122.1    JTDY01004843    KOB67682.1    AGBW02014789    OWR41062.1    NWSH01001458    PCG71170.1    KZ149911    PZC78108.1    BABH01003829    BABH01003830    BABH01003831    AK402758    BAM19368.1    KQ460883    KPJ11152.1    ODYU01006526    SOQ48459.1    KQ459603    KPI92808.1    OWR55011.1    JTDY01001201    KOB74558.1    AJVK01032026    ATLV01012991    KE524833    KFB37100.1    AAZX01003729    KQ435703    KOX80330.1    HQ245150    AEB91339.1    KQ971348    EFA05534.2    HQ245152    AEB91341.1    GL434548    EFN74792.1    GEDC01022255    JAS15043.1    AXCM01002814    GL448571    EFN84154.1    KQ982937    KYQ49100.1    DS235784    EEB16960.1    AAAB01008844    EAA45200.5    APCN01003125    KQ414579    KOC71135.1    KQ981296    KYN43080.1    GL888284    EGI63349.1    KQ759784    OAD62863.1    KQ980314    KYN16692.1    KZ288238    PBC31353.1    KQ976532    KYM81561.1    KQ434869    KZC09314.1    GAPU01000071    JAB84774.1    GBXI01003797    JAD10495.1    GAKP01003902    JAC55050.1    KYB26873.1    JXUM01027342    KQ560787    KXJ80883.1    JXUM01024565    KQ560694    KXJ81242.1    GL763984    EFZ18947.1    KK854321    PTY14631.1    DS235131    EEB12342.1    AXCM01005241    LBMM01006355    KMQ90671.1    ADTU01026685    ADTU01026680    CCAG010013550    JXUM01102122    JXUM01102123    JXUM01102124    JXUM01102125    KQ564702    KXJ71872.1    CH477801    EAT36071.1    OUUW01000003    SPP78683.1    GARF01000007    JAC88928.1    RVE50268.1    JXUM01056073    JXUM01056074    KQ561895    KXJ77234.1    CH477290    EAT44645.1    QOIP01000012    RLU15835.1    KYM81568.1    KQ978473    KYM93710.1    GECZ01023220    GECZ01012360    JAS46549.1    JAS57409.1    PCG71174.1    GL888048    EGI68822.1    KQ979701    KYN19666.1    GDRN01108842    JAI57158.1    GEDC01024026    GEDC01011147    JAS13272.1    JAS26151.1    GDHF01030739    JAI21575.1    AXCN02000040   
Pfam
PF05199   GMC_oxred_C        + More
PF00732   GMC_oxred_N
Interpro
IPR007867   GMC_OxRtase_C        + More
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR036188   FAD/NAD-bd_sf       
SUPFAM
SSF51905   SSF51905       
Gene 3D
PDB
5OC1     E-value=5.40996e-38,     Score=396

Ontologies

Topology

Length:
443
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01425
Exp number, first 60 AAs:
0.00027
Total prob of N-in:
0.01106
outside
1  -  443
 
 

Population Genetic Test Statistics

Pi
151.268591
Theta
155.37999
Tajima's D
0.056625
CLR
11.400965
CSRT
0.386280685965702
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号