SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09557
Pre Gene Modal
BGIBMGA013019
Annotation
PREDICTED:_uncharacterized_protein_LOC105842057_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 3.727
 

Sequence

CDS
ATGCCGAAGGTTACGGATGGAAAAAAATATACAAAAGCATATACAGAAGAAGATATAGAAAAAGCTTTGCAAGCCATAAAAAATGGAATGGGTAAGAAAACTGCTGCAAATAAATTTAATATCCCAAGAGCAACTTTGCAGTTCCGCCTATCCAACCAATTTGTCAAAAGTCGACCTGGTCCAGATACAGTTTTATCTAGTGCAGAAGAACAAGAGATAGTTAAATGGATAATTGCAGCTTGTAGAAAAGGATTTCCACGGCGTAAAGAGGATGTCATAAAGAGCGTCAAACTGTATTTGGATGAACATCCCAGACCAAACAGTTTTATAGATAATACACCAGGCGAGGGATGGTATAAATTATTTTTGAAGAGGCATCCTGAGCTTTCTATACGAACATCAGAGGCTGTAACTTCAGCAAGCTCAAAGTTGTCAGAGAAGCAAATTAGAAACTGGTTTACACAAGTAGAAGAATATCTGAAAGAAAATGATCTCTTTCATATTTTGAGTGATCCATCTAGAGTTTACAATGGGGATGAAACGAATTTTATTTTATGCCCAAAGAACACCAAAGTTATCGCTTTAAAGGGAACCAAACATGTGTATGAGGTAGATCACGCTCAGGCTAAATCATGTGTTACTGTAATGTTCACATTTTCGGCGGATGGTGTAACAACACCACCTATGATTATTTACCCTTTAAAGAGAATGCGACCTGAGATTCAAAAGTCTGTGCCTAGCGAGTGGGGTATTGGCTTGTCAGATAATGGATGGATGAAGGCGGAGCTTTTCATCCAGTACATACAGAATGTTCTGCATCCAGCGCTAATGAAGATGAATATCACTTTTCCAGTAATTCTTTTTTTAGATGGACATAAAAGCCACACAACACTTCAGCTTACTCAACTTTGTCAAAATCTTGGTATAATACTTATAGCTCTATACCCTAACGCGACACGGATTTTGCAACCAGCAGACGTAGCGGCATTTCGTCCAATAAAAGTAATGTGGCGTAAAGCAGTCCTAGAATGGCGAACAGATAACTTAACAAAATCTTTACTAAAAACAGATGTTGCTCCTATACTGGAGAAGCTTTTACCCAAATTAAATAAAACGACTTTGAAGAACGGCTTTGAAGCTTGTGGTTTATGCCCATTTAATTCAGATCAAGTGGACTACACAAAATGTTTAATGCCCTATAAACCAGTCCAAGAAATTTTGGATGACAACTGTTCTACAAGTCTTAACTATCAGAAATTCGAAGAAATAGTTGGACCACAGTTAATCAGAAAGATGAAAAATCAGGTGGTAGGTAAATCAAGAGAAGCTAAAAAGCTTCACGATTTGTATAAATATCTCGTACCAAAAATGTCAACACATGAGTCATCGTCACAAATCATAGAAACAACTTCTAAGGAACTAATGCAATACAAGGACAGGAGCAATTTAAATGAACAAAACAACGATGGTTCAGAAGATTTCACCACAATGGCAGCCCTCAATGAATTAACGACAATGCCAACAGACGTAGAACTTTTGCTAAATGAACCAGAACTGTCAACGCATGAACCTCAATCCAAAGACACTGGCACTTCTAAAACAAACACGATGATTGATGATTATTCAGGAACCTCAGGACACCTAAAACCTCTGAACGTTGAACTTCAGCATCAGGGGGTTGAGGAATTATCTTTGGCATCCTGTATAAATCTTACATCGACAAACGATCCAATACCAGAAGCTGTACAAATGGTTGAGGTTATTTCTGAGTGTGAAAAAGAAAACCAAACACCAATATACGTAATACCTATTCCATCCACTAGTCGTCAAAGTTTAGAGCTGATTGGAGAAAAATGGGTACTAGTGGATGACATGCCAACCGAAGTCCCTTCAAAGAGTCCAATAAAGAAACAAAATATAAAAGATTTTTTAAAGTTACCAAAGACTCCAATTAAAACACAAAAAGCTGGTATAGAACGTCGCTCTTTTGTTTTAACGAGTAAAGATTGGGAAGCTGTAGAACTAGAAAAACAACAAAAAAAGATGAAAGAGATACAAGAAAAGGAGAACAAACGAATAGCAAGACTAGAAAAAGCCAAAGAGAAACGCTTACTCAAGGAAACAAAACAAGCTGAAACTATAAATAAAAAGAACAAAGCTAAAAATTTAAATTTAATTAAGAAAAGTAAGCCAAATTCTGATAGTATCAAATCAAAAATTGTTATTCAATCAAATGTTTTAATTAAGCCTGCAAATAGAATCTCAAGTGATATTAAAGAAAAAAGAGAATATACAAAAGAAATTAAAAAAGGACCTATGAACGAAGTTAAACCTGCAGATATTACTGCCCTGAAGGAAATAAAAAACAGGCCAATTTTAGATGCAGTTGAAGCTGCAAATGAAAGACTCTTTAAAGAATCGGAACAAGTACAGATGGTAAAAAAAGAATTAAAGAAAGGACCAACTTTAGATGAACTTAAACCTCCGAACATAACTTTCCGAGATTCAAGGGAAACCGGAAAAGATAAGAAGATAAAAATTAAAGTAAATAGATTGAGACCAATGACAGATGAAGAATTGTTAAAAATGTTGGAAGATGATTAG
Protein
MPKVTDGKKYTKAYTEEDIEKALQAIKNGMGKKTAANKFNIPRATLQFRLSNQFVKSRPGPDTVLSSAEEQEIVKWIIAACRKGFPRRKEDVIKSVKLYLDEHPRPNSFIDNTPGEGWYKLFLKRHPELSIRTSEAVTSASSKLSEKQIRNWFTQVEEYLKENDLFHILSDPSRVYNGDETNFILCPKNTKVIALKGTKHVYEVDHAQAKSCVTVMFTFSADGVTTPPMIIYPLKRMRPEIQKSVPSEWGIGLSDNGWMKAELFIQYIQNVLHPALMKMNITFPVILFLDGHKSHTTLQLTQLCQNLGIILIALYPNATRILQPADVAAFRPIKVMWRKAVLEWRTDNLTKSLLKTDVAPILEKLLPKLNKTTLKNGFEACGLCPFNSDQVDYTKCLMPYKPVQEILDDNCSTSLNYQKFEEIVGPQLIRKMKNQVVGKSREAKKLHDLYKYLVPKMSTHESSSQIIETTSKELMQYKDRSNLNEQNNDGSEDFTTMAALNELTTMPTDVELLLNEPELSTHEPQSKDTGTSKTNTMIDDYSGTSGHLKPLNVELQHQGVEELSLASCINLTSTNDPIPEAVQMVEVISECEKENQTPIYVIPIPSTSRQSLELIGEKWVLVDDMPTEVPSKSPIKKQNIKDFLKLPKTPIKTQKAGIERRSFVLTSKDWEAVELEKQQKKMKEIQEKENKRIARLEKAKEKRLLKETKQAETINKKNKAKNLNLIKKSKPNSDSIKSKIVIQSNVLIKPANRISSDIKEKREYTKEIKKGPMNEVKPADITALKEIKNRPILDAVEAANERLFKESEQVQMVKKELKKGPTLDELKPPNITFRDSRETGKDKKIKIKVNRLRPMTDEELLKMLEDD

Summary

Uniprot
Pfam
PF03184   DDE_1        + More
PF05225   HTH_psq
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR006600   HTH_CenpB_DNA-bd_dom       
IPR009057   Homeobox-like_sf       
IPR007889   HTH_Psq       
SUPFAM
SSF46689   SSF46689       
ProteinModelPortal

Ontologies

Topology

Length:
867
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.24782
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01071
outside
1  -  867
 
 

Population Genetic Test Statistics

Pi
261.164593
Theta
201.482251
Tajima's D
1.090883
CLR
100.991823
CSRT
0.684665766711664
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号