SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09544
Pre Gene Modal
BGIBMGA012819
Annotation
PREDICTED:_uncharacterized_protein_LOC105842067_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.966
 

Sequence

CDS
ATGTTGGTTAGTCTGTGTCTGTTGGCAGCACTCATCGAAGTCAAAGCGGCTGATTTTAATGGGGAAGATTACTGGCTTCTTCCTCGTCTCTTCGATTTGGACAACTACGATGAGTGTCTTTCGCATCCCGACGGCTTGTACTGCCTCGGCAGCTTCCATCTCACACCTGCTGAACAACCGAACCGTGTTTACGAATTGATGACTAACTATTCAAAGGAATTGTATAGGTTCAATCGCACTGTTATCCGACGTGGATGGTGTGTTAGTGCACGTGAATCGAATGTAACAGCGGAGCCGATGAATAGGTTTGAGCACTGCGCCGCGGAGTGGGCCCGCTCTCGTCGCATGCGCGCCCGTCTACTCAGACTGGAGTACTGCAGGAGCCATAGCGACGTACACGCCACACGGATCCCTGACAAGTCCGAACTAACCTTTCTCATTGCGATAGCTGTGATAATATTATTGAACGCAGCCAGTACCGCGTATGATTACGCCACTCAGAATAATGAGAAAAAGATTGCTCTCCTAACAACCTGGTCTGTTGTCGCCAACTGGAGGCAACTAGTTGAACCTTATAACTCACATCGGAAATCTCTACAAGCAATCCAAGGAATAAAAGTTATAGTTTCTGCGAGTATCTGTATTGTGCATAGTGGAATGTTGTTATATACATTGTTCTTGTATGAACCGATAGAAATGGAGCAGGTAATAGCGAATCCATTAACAATGGCGGTCCAGAACAGTACGACGGTCGTGCACATGTTCATTGTACTGTCAAGTTTCCTTACTGTTCACAATCTGTTAAAGTCAAGCAAACCGTTTGGTTTCGGTACATTCTTAAGGTTGCTCGCGAAAAGAATAATTAGATTAAGCCCTGTGTGTCTATTGGTGATCGGTTTCGCCGGGACCTGGTGGCCGCGGGTCAGTGACGGACCTCTGTGGCCGGCTGCGGTCGCGGAGCAGAGTAAGATCTGCCGCGAGAAGTTCTGGGCGCACGCGTTCTTTATCCATAACCTGGTGGAACCGGACAAGTTCTGTTTGATACCGACCTGGTATATAGCGGTCGACATGCAGATGTACATACTGGCAGTTATCTTAACAATGATCCTGGCCAAGTTCAGTAAGAAGGCTGTGCCGATTCTCGTGATTCTATTCATAGGAGCCACAGCGTTGAATGCGGGGTTGGCGTACATATACGAATGGAAGTCATTGTTGTATTTGGCAATAGTCGCAGAAAATATCAACTCTATATTCCGTGATATTCCATCATTGAGCCACTTTTACATGTCGCCTTGGGGCAGTCTTCCAGCGTGTCTCGTGGGACTCATCATAGGACATTTGGTCCATTTTACTAAGGGAGAAACATTTGGAAACATATACAAGCGACGGCTCCTCAGCTTATATTACGTTCTGTGTATACCTATCATGGTGGGCTGGTTGATGCTGGGTAACTACTTCCAGCATATCCGACATCCGATCTTCGTAGCAGCGTACGCGGCTCTGGAGAGATCTATCTTTCAGATTATGTGCATCCTTGCGTATATAGCATTAGTCTTCAAAAATGATATTATTATATGCTTTAAAGCACTCGCCTGGCGAGGGTGGCATCTGTTGGCGCAGCTCTCTCTGCCCGTGATGCAGATACACTGGTGCATAGCGTTGGTCATCATTGGTCCATCGCCTCAGCCGGTTGCGGTTTCGGTCATTAACTTGCTACCGGTTAGCGTTACCACAGTCTGTTTCACGTATCCACTGGCATTGTTATTGACTGTACTGTTGGATATGGGACCAAAGGTAGGCAATCAATCAGTTAGATATGGGAGAAAAGGTAGGCAATCAATCAGTTAG
Protein
MLVSLCLLAALIEVKAADFNGEDYWLLPRLFDLDNYDECLSHPDGLYCLGSFHLTPAEQPNRVYELMTNYSKELYRFNRTVIRRGWCVSARESNVTAEPMNRFEHCAAEWARSRRMRARLLRLEYCRSHSDVHATRIPDKSELTFLIAIAVIILLNAASTAYDYATQNNEKKIALLTTWSVVANWRQLVEPYNSHRKSLQAIQGIKVIVSASICIVHSGMLLYTLFLYEPIEMEQVIANPLTMAVQNSTTVVHMFIVLSSFLTVHNLLKSSKPFGFGTFLRLLAKRIIRLSPVCLLVIGFAGTWWPRVSDGPLWPAAVAEQSKICREKFWAHAFFIHNLVEPDKFCLIPTWYIAVDMQMYILAVILTMILAKFSKKAVPILVILFIGATALNAGLAYIYEWKSLLYLAIVAENINSIFRDIPSLSHFYMSPWGSLPACLVGLIIGHLVHFTKGETFGNIYKRRLLSLYYVLCIPIMVGWLMLGNYFQHIRHPIFVAAYAALERSIFQIMCILAYIALVFKNDIIICFKALAWRGWHLLAQLSLPVMQIHWCIALVIIGPSPQPVAVSVINLLPVSVTTVCFTYPLALLLTVLLDMGPKVGNQSVRYGRKGRQSIS

Summary

EMBL
NWSH01000045    PCG80260.1    BABH01004270    BABH01004271    KZ150097    PZC73595.1    + More
ODYU01009435    SOQ53859.1    KZ149997    PZC75398.1    NWSH01000169    PCG78819.1    AGBW02007654    OWR54851.1    ODYU01002360    SOQ39759.1    KQ460635    KPJ13420.1    KQ459582    KPI98971.1    PCG80259.1    KPJ13421.1    PZC75396.1    KPI98970.1    PCG80257.1    OWR54850.1    RSAL01000280    RVE43059.1    JTDY01006392    KOB66051.1    ODYU01003108    SOQ41449.1    KPI98974.1    ODYU01007420    SOQ50170.1    SOQ50174.1    NWSH01001667    PCG70472.1    AGBW02012502    OWR44975.1    SOQ50171.1    KZ150068    PZC74094.1    AGBW02008687    OWR52781.1    RSAL01000205    RVE44373.1    PZC74095.1    KQ459449    KPJ00879.1    ODYU01007576    SOQ50462.1    KQ459053    KPJ04119.1    KQ461184    KPJ07529.1    JX846987    AGG55004.1    KPJ04127.1    KPJ07525.1    NWSH01001633    PCG70632.1    KZ150085    PZC73777.1    GEZM01042633    JAV79751.1    DS232017    EDS31995.1    CH902619    EDV36810.2    BABH01025581    AAAB01008807    APCN01000146    EAA04081.4    KQ459900    KPJ19352.1    AXCM01001275    EAA03947.5    BABH01038834    AE013599    AAF57404.4    ATLV01023202    ATLV01023203    ATLV01023204    KE525341    KFB48579.1    CH477771    EAT36390.1    AXCN02000448    AXCN02000449    NEVH01017478    PNF24171.1    GEZM01074205    GEZM01074204    JAV64641.1    ADMH02001642    ETN61640.1    CM000071    EDY68727.2    KPJ00884.1   
Pfam
PF01757   Acyl_transf_3        + More
PF00089   Trypsin
PF02958   EcKinase
Interpro
IPR002656   Acyl_transf_3        + More
IPR009003   Peptidase_S1_PA       
IPR001254   Trypsin_dom       
IPR004119   EcKinase-like       
IPR011009   Kinase-like_dom_sf       
IPR015897   CHK_kinase-like       
IPR006621   Nose-resist-to-fluoxetine_N       
SUPFAM
SSF50494   SSF50494        + More
SSF56112   SSF56112       

Ontologies

Topology

SignalP
Position:   1 - 16,         Likelihood:  0.994234
 
 
Length:
615
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
238.94591
Exp number, first 60 AAs:
0.02249
Total prob of N-in:
0.00859
outside
1  -  142
TMhelix
143  -  162
inside
163  -  206
TMhelix
207  -  229
outside
230  -  248
TMhelix
249  -  268
inside
269  -  287
TMhelix
288  -  305
outside
306  -  347
TMhelix
348  -  370
inside
371  -  376
TMhelix
377  -  399
outside
400  -  427
TMhelix
428  -  450
inside
451  -  462
TMhelix
463  -  485
outside
486  -  504
TMhelix
505  -  527
inside
528  -  533
TMhelix
534  -  556
outside
557  -  570
TMhelix
571  -  593
inside
594  -  615
 
 

Population Genetic Test Statistics

Pi
181.02389
Theta
173.522513
Tajima's D
0.758003
CLR
0.433525
CSRT
0.592070396480176
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号