SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09514
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 1.533
 

Sequence

CDS
ATGGCGCAGGCGATAGCGGACGAATTGGACATCGCAGTCGGTGTAAGGACGTACTGGACTGACTCCAGTACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTCGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAAAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCGCGAACATTCAAGCAAGAACCGTCTGGAGAAGAGAAAGAGGCCTACCTGGTCGCTACGGCGAGGACCGCTGAAGCTCAACCCACGCCCGATCCGCACAGATTCTCGAGCTGGGTCAGGTTATTGAGAGCAACAGCCAGGGTCCTCCAATTTATCGAGCTGTGTCGACCCCGGAAGGAGAGCGCCTGCGTGTCCAGACAATCGAAGCAGCAAGATCCCACGTGGAGGACGACACGAACGAAGCAACCCCGATCCACATGGAAGTTAAGGACCCCGGAAGCACCTACAGAAGCATGGCTGCCGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAACAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGGTAACCACGCAACGGTGATGAACGAGTCATTTTTCGATGTGGCCATGGCGTTCTTTATAAAAAACAAAATGTTTGGTTTAACAATAACTTTGAACACTTTATCATGGGCTGGATTAATAATGCGAGATCAATACACGAAGACTCAAAGGATCATCGTCAGAGTGTATGCATGGCTGGTTTTCCTATATCTATTTGTTGCTGCAGCTTGCGTACAAATCGCGGACATTATTGACATCTGGGGTGACATTAATCTCATGGCGGAAACAGCTTTGCTTCTCTTTATGGAATTCGCAGTGATTTCTAAGATTTTAACCTTGTTATTGAGATACGATAGAATAATGGAGATCATCAATGGAACTGAAGAAATATTGTATTTTGAAAACGGATTGGAAGGCCAAAGGATTATCGCAAGGATGGTTCTGTCCAATGGTTCTGTAAAGGCTTGGCTTGGCTTGGCCATGGCTTTGGTAAAGCTGTCGTTTGCTAATACCGAAATCAATTACAATAATTAG
Protein
MAQAIADELDIAVGVRTYWTDSSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAYLVATARTAEAQPTPDPHRFSSWVRLLRATARVLQFIELCRPRKESACVSRQSKQQDPTWRTTRTKQPRSTWKLRTPEAPTEAWLPLDPPHLKKAEKILLRNSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHGNHATVMNESFFDVAMAFFIKNKMFGLTITLNTLSWAGLIMRDQYTKTQRIIVRVYAWLVFLYLFVAAACVQIADIIDIWGDINLMAETALLLFMEFAVISKILTLLLRYDRIMEIINGTEEILYFENGLEGQRIIARMVLSNGSVKAWLGLAMALVKLSFANTEINYNN

Summary

Pfam
PF05585   DUF1758        + More
PF17921   Integrase_H2C2
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF03564   DUF1759
PF00628   PHD
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR005312   DUF1759       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       

Ontologies

Topology

Length:
457
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
71.60632
Exp number, first 60 AAs:
0.01384
Total prob of N-in:
0.02671
outside
1  -  310
TMhelix
311  -  328
inside
329  -  340
TMhelix
341  -  363
outside
364  -  372
TMhelix
373  -  395
inside
396  -  457
 
 

Population Genetic Test Statistics

Pi
361.682861
Theta
212.496478
Tajima's D
1.647029
CLR
176.409172
CSRT
0.821908904554772
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号