SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09489
Pre Gene Modal
BGIBMGA012804
Annotation
reverse_transcriptase_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.539
 

Sequence

CDS
ATGAAGTTAAATCCCTTAAAAAACCCTCAACCACAACACAAACTGCTTACTCAGCAAGCACTCCTTCCAGGCTTGTTTGACAGACAACGTTCGTCATCCCTTTCCGACCTGGGAAAGTCACCACAAGATACGACCAATGTAGATCAACCAAATGTAGCCAGTATCACACCGGTAGCAACCTTGCTGGAAGACATTCCTCAACCCCCTGCTCCTCCACCATGGCAAAGGGTACCATCACCCAATAGCAGAAGCAGTAAGAAAAGAAAGTACTCCAGTTCCTCACCAGAGGCCCCAAGTACCACTGTGAAAAACCGCTTCAGCACCTTACCTCTAGACGCAACGGATGAACCATGCACTACCGATCGCCCTAAGCCCAGCAAACCTCCACCTATAGTACTCAATGGTATAGAAGATGTTACAGAGCTATCGAAGTTACTTCAAACCGTCAGTAGCAAAGACGATTTCAAATTTAAACTAATTAATAAAAACCTACTTCACATTCTGGTTAACAATGCTGAGGAGTATAAAAAAATCATAGCGGTAATAAGAGCAAATGGACTCATAGGACACACATTCACCCCTAAAGATATCAAATGCTATCGCATTGTCATAAAAGACCTCCACCACAGCACACCCCATGAAGCGATAACTGAAGCCATTGAGGCAACTAACAATAAAATTAAAGGCGAAATCATCAATGCACGTTACGGACCCGACAAGAAACCTACATCTACATTCTTTGTAAACATTGAGCCCAGCGTAAATAACCCGGCAGCCAAGAATATAACCCATATATTTAACCAAAAGGTCAAGATAGAGGATCCTCGCAAGTCAAAAAGCTTTGTTCAATGTCAACGTTGCCAGCGCTACGGCCACTCAAAAAATAACTGCATGAGACCATATAGGTGCGTTAAATGCGGTGAGGGTCACAAAACCTCAGAGTGCCAAAAGAAAGATAGAACCACACCGGCTAAATGCGCTCTCTGCTTGTGTGACCACCCGGCTAACTACAAAGGCTGCGAAATTTACAAGGAAATCCTTGCCCGAAGAAACAAAAACTTAACTCCAAGAGAAAGGCAATCCGCTCTATCTATCACAGCCTTGCCTATTAATCCAATCAGCTCCACATCGACAAAAACTGAAGGTATCGAAAGACCAACTCAACAACGAACTTATGCTGAAGTCGCCGATGGGAGGAATTCCCAATCTAATCAACAATCCTACAGCAAACTGGAAAATATCCTACTTAAACAAACTTCTAAAATGACCTCGCTGCATATTGCCACTTGGAACATCAACGGCCTAGCCCCTAATAAAAACGAACTAGTGACGTTCATCAAATCTAATAAGCTTGATGTTTGTCTTGTCTCTGAATCGCACACCACACCAAGAAGCAGAATATGTGTTCCAGGCTTTTCGGTGTACATCACCTGTCATCCTGATGGAGGGGCCCACGCTGGCACCGCGATAATTATCAAGAACAGTATAAAGCATTACCTCCTGGAATCTATTGCGGCTCCCTATCTCCAAGCCACAACTGTAAGGGTGGAGGATCGTTCCGGACCCCTAATTCTTTCTGCAATATACTGTCCACCGCGCCACGCAATAAAGGAGAAAATGTTTACTGAGTTTTTTATGTCTTTAGGCAACCGATTCATTGCTGGTGGCGATTGGAATGCCAAGCATACATACTGGGGCTCAAGATTAACAGTAACTAGAGGTCGGGAATTAAAAAAGAGCATTGAAAATAATCACTTGTTAGCTATGACAACTGGAGAGCCGACATATTGGCCTACGGACAGTAACAAAATACCTGACCTCCTGGATTTCTTTGTTACTAAGGGTATTAGCGCACAAAATACTCTGATAAAGGCAAGTCTCGACGGCAGCTCTGACCATTCACCTGTCTTGCTTACACTTAGCTCAATGGCCATGCCCAGCGATACCCATACCGTCTATCTCCACAATTATAAAACTGATTGGCAATGTTTTCGGGAATTCCTCGAATCAAACATAAACCTATGTATCCCACTAAAAACCAAAGCTGACGTTGACGACGCATGCCTCTATATTACAAACCTTATTCAAGTGGCGGCTTGGTCTAGTACACCTGAACTGAAGGGTCCTTCGAGAGAGGCGCCGGTCCCTCTTGTTGTCAAGGAAAAAATCGCCGCCAAACGTCGCCTTCGCAAAATTTGGCAGACAACCCACCGATGTGCGGATAAAACCAGACTAAATCGAGCTATTAAAGAACTCAAAGATCTTCTGGATTACGCTTCAAACGATTCACTCAAGCAGAGATTGGAAAAAATGTCTCCAAATGCAAATGGCTCTCACAACCTCTGGAAGGCAACAAAGTACCTCCCACAGCCGCAACGGTGCTCTCCGCCTTTAAGATCCGGTAATAAATGGGCGCGAACTGACCAGGAAAAATCTCAGGCCTTCGCTATATACCTGGCTGAAGTATTTAAACCCAACAATACGGATAGTCCAGAGGATCCCGAAATAAATCGAGTATTAAAGCAAGACTTGCAATTATGCCTACCCCTGAGTCCTACTACACCAAAAGAGATTGCTAGAGAAATAGTCAAAATGGACCGTAATAAAGCGCCTGGATTTGACTTGGTTACCCCCAGACTGTTGAAAGAGCTCCCTAGGAGGTGCATTCTCTTTTTGACCATTCTTGTCAATGCTACATTGAGAATATCGCATTTCCCTGCACTCTGGAAAACATCCCAAATTGTGATGATCCAAAAACCTGGTAAACCGCCTAACGAGTTGTCTTCTTATCGCCCTATAAGCCTGACACCGGTTTTGTCAAAGTTATGGGAAAGGATCATCTTGGCACGATTATCTCCTTGCCTAGATACATGCCATGTAATACCTGACCACCAATTTGGCTTCCGAAAGCACCACTCAACCATAGAACAGGTACACAGAGTGTATTGCACAATAAGACATTGTCTGGAGAGGAAAGAGTACTGCTCGGCTGCTTTTCTCGACGTGCAACAAGCTTTTGATCGGGTTTGGCATAAAGGACTGCTCTGCAAAATTAAAAAGTACCTTCCACATTCCTACTTTCTGCTATTAGAGTCTTATCTCAGTGACAGAAAGTTTCAAGTCAAGCTCCGTGATGCCAGATCTTCTCTTTTTGCCTGCAGAGCCGGAGTGCCTCAAGGCTCCGTACTTGGTCCGGTCCTCTACAACATTTTTACTTGTGATCTACCCCAGTCACCAGAAATAGCGATAGCAACCTTTGCCGATGATGCAGCCTTCCTCAGTTGTAGCAGTGATCCCAATGAAGCGACCAGACTGTTGCAAACCCAGCTCGATATCACTAACACTTGGATGACCAAGTGGCGCATAAAAGCAAGCGCCCCCAAGTCTCACCACATCACATTTACCCTAAGACGTGAAACTTGTCCTCCAGTCAAACTCGGCCCCGATACATTGCCGCAATCAACCTGTGTTAAGTATCTTGGATTTCACTTGGACCGAAGGATGACATGGAAAGACCACATAAAAACAAAACGTAATGAAATTAACATTAGATTTAAAAACCTACTCTGGCTTCTCGGTAGACAGGCTGCCTTATCCCTATCCAACAAGTTAAGGGTGTATTGCTCAATAATAAAACCGATTTGGACGTATGGAATCCAACTGTGGTCGACAGCAAGCAAATCCAACATTATGTGCCTCCAGAGAGCTCAAAACAGTATCCTGAGGGTACTTTCGTCGGCGCCTTGGTATACTCGAAATTCGGAAATCCACGAGTACCTGGAAATCCCAACCATCTTGGATGAAGTTAAACGATACTTAGCCAACTATAAGAACCGCTTGAAAGCTCACCCAAACCCGTTGTCCGGCTTACTATTGCAGCCAAATCCAATTAAAAGACTCAAGAGAGCCGACGTGCTACCCTACTAA
Protein
MKLNPLKNPQPQHKLLTQQALLPGLFDRQRSSSLSDLGKSPQDTTNVDQPNVASITPVATLLEDIPQPPAPPPWQRVPSPNSRSSKKRKYSSSSPEAPSTTVKNRFSTLPLDATDEPCTTDRPKPSKPPPIVLNGIEDVTELSKLLQTVSSKDDFKFKLINKNLLHILVNNAEEYKKIIAVIRANGLIGHTFTPKDIKCYRIVIKDLHHSTPHEAITEAIEATNNKIKGEIINARYGPDKKPTSTFFVNIEPSVNNPAAKNITHIFNQKVKIEDPRKSKSFVQCQRCQRYGHSKNNCMRPYRCVKCGEGHKTSECQKKDRTTPAKCALCLCDHPANYKGCEIYKEILARRNKNLTPRERQSALSITALPINPISSTSTKTEGIERPTQQRTYAEVADGRNSQSNQQSYSKLENILLKQTSKMTSLHIATWNINGLAPNKNELVTFIKSNKLDVCLVSESHTTPRSRICVPGFSVYITCHPDGGAHAGTAIIIKNSIKHYLLESIAAPYLQATTVRVEDRSGPLILSAIYCPPRHAIKEKMFTEFFMSLGNRFIAGGDWNAKHTYWGSRLTVTRGRELKKSIENNHLLAMTTGEPTYWPTDSNKIPDLLDFFVTKGISAQNTLIKASLDGSSDHSPVLLTLSSMAMPSDTHTVYLHNYKTDWQCFREFLESNINLCIPLKTKADVDDACLYITNLIQVAAWSSTPELKGPSREAPVPLVVKEKIAAKRRLRKIWQTTHRCADKTRLNRAIKELKDLLDYASNDSLKQRLEKMSPNANGSHNLWKATKYLPQPQRCSPPLRSGNKWARTDQEKSQAFAIYLAEVFKPNNTDSPEDPEINRVLKQDLQLCLPLSPTTPKEIAREIVKMDRNKAPGFDLVTPRLLKELPRRCILFLTILVNATLRISHFPALWKTSQIVMIQKPGKPPNELSSYRPISLTPVLSKLWERIILARLSPCLDTCHVIPDHQFGFRKHHSTIEQVHRVYCTIRHCLERKEYCSAAFLDVQQAFDRVWHKGLLCKIKKYLPHSYFLLLESYLSDRKFQVKLRDARSSLFACRAGVPQGSVLGPVLYNIFTCDLPQSPEIAIATFADDAAFLSCSSDPNEATRLLQTQLDITNTWMTKWRIKASAPKSHHITFTLRRETCPPVKLGPDTLPQSTCVKYLGFHLDRRMTWKDHIKTKRNEINIRFKNLLWLLGRQAALSLSNKLRVYCSIIKPIWTYGIQLWSTASKSNIMCLQRAQNSILRVLSSAPWYTRNSEIHEYLEIPTILDEVKRYLANYKNRLKAHPNPLSGLLLQPNPIKRLKRADVLPY

Summary

Pfam
PF00078   RVT_1        + More
PF07530   PRE_C2HC
PF14529   Exo_endo_phos_2
PF04937   DUF659
PF03372   Exo_endo_phos
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR007021   DUF659       
SUPFAM
SSF56219   SSF56219        + More
SSF140996   SSF140996       
SSF53098   SSF53098       
Gene 3D
PDB
6AR3     E-value=0.00264107,     Score=101

Ontologies

Topology

Length:
1308
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02171
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1308
 
 

Population Genetic Test Statistics

Pi
278.726796
Theta
200.532528
Tajima's D
2.891239
CLR
0.366559
CSRT
0.975201239938003
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号