SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09458
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Integrin beta       + More
Sodium/hydrogen exchanger      
Location in the cell
Mitochondrial   Reliability : 1.544 Nuclear   Reliability : 1.797
 

Sequence

CDS
ATGACCCTGGCGACTCTCAATACCCGGACCCTGCGGCTTGACGAACATATTGAGGAACTGGAAGCGGAATTAGGAAGGATACGATGGCACGTACTAGGGTTGTGCGAAGTCCGAAGACAGGGGGAGGACGTCATAACTCTGGACTCAGGCCACCTATTCTACTTCCGGGAAGGAGACCAACCTGGACAAGGTGGAGTTGGCTTTCTCGTCAATAAAATCCTGACGGACAACATTATAGAGGTATCCAGTGTGTCGACACGGGTAGCGTATCTCGTAATTAAGCTCACCGAAAGGTACTCTCTTAAGGTGGTGCAAGTATACGCACCGACTTCGTCATACTCGGATGACGATGTGGAGATTGTGTACGACGATATCACCAGGGCTCTGCACGATACCACAAAAGCCCACTTCAATGTTGTCATGGGAGATTTTAACGCTAAAGTGGGAGTACAGACTTGCGACGAATCGGTGCTAGGATCCTTCGGTTATGGATGTAGGAACCACAGGGGGCAAATGCTAGTCAACTTCCTTCAGCGTGAGAGGCTCTTTCTAATGAACTCGTTCTTTAAAAAGAAGCCACAAAGGAAGTGGACTTGGCTAAGCCCCGACACTGTGACGAAAAACGAGATAGACTTTATTATGACGGACAAGAAGCATATATTCAGGGATGTCTCTGTGATCAGCAGGTTCAATACCGGTAGTGATCACCGACTTGTCAGAGGCACACTGAATATGGACTTCAAGTTAGAACGCACTCGTCTAATAAAGTCTACGCTTCGACCCAGCCTACATCACATGGCTGTAGATCCGGAGCAATTCCAGCTAGATCTCCACAACCGATTCGCTGCCTTGGAAACCACCACAGACGTAGACGAGGCCTTAGATGGCGTGGTGAGGACACTGAGACAGGAAGGACAGAGACTGTGTCCAAAGGGTCGTACAGGCAGAACATCAAAGTTATCATCCGAGACTCTCCGGCTAATGGAAGAAAGGCGAGAAAACACACAGGCCACACAATCAGAGAAGGTGGCTCTTAATAAGAAAATCAGGACGCTGGTACGACGCGATCTCCGACGGTACAATACTCAGCGGATCAATGACGCAATCGAGCAAAACCGAGGAGCCAAGGTGTTCGTGCAGCCTCTTGGTAAAAGCCACCTTACAAAACTGACCAAAAAGGATGGCCAAATTCTCGCCTCCAAACCGGAGATTCTCAAGGAACTTGAGGACTTCTACGGAGGCCTCTATACTTCCAAAGCAACTAAGCCTGTCTCCGACCCAGCAGATGTCCGAGCCACACTGTCCCGCCACTACACCGACGAGCTGCCACAGATTAGTGTAGACGAGATCGGGATGGCTCTTGAAAATCTTAAAAACGGAAAGGCCCCGGGGGAAGATGGTGTTACTTCTGAGCTCTTGAAAGCAGGAGGTCTTCCTGTTATTAGGGAGCTCCAGAAGCTCTTCAACACTGTCCTCTTTACCGGTAAAACTCCAAGGGCGTGGAGCAGGAGCATAGTTGTCCTTTTCTTTAAGAAAGGAGATAAAACACTTTTAAAGAATTATCGCCCCATCTCGCTCCTGAGCCACGTCTACAAATTGTTTTCAAGAGTCATAACGAATCGTCTTGCTCAGAGACTTGACGACTTCCAGCCTCCGGAACAGGCAGGATTCCGAAGAGGATTTGGTACCGTGGACCACATTCACACAGTTCGGCAGATTATACAGAAGACTGAAGAGTATAATCTGCCACTATGTCTGGCGTTTGTGGACTACGAGAAAGCCTTTGACTCGATCGAGACCTGGGCTGTTCTGGAATCTTTGCAGCGGTGTCAAGCTGACTGGCGATACATCGATGCACTAAGATGCTTGTACGATGCCGCTACAATGACCGTCCAAGTACAGAAAGACCAGACGAGACCAATCCAGTTGCGCAGAGGTGTAAGACAGGGGGATATTATATCCCCGAAACTGTTTACAAACGCACTGGAGGACGTTTTCAAGACTCTGGACTGGAACGGACGCGGCATTAACATAAACGGCGAGTACATCTCACATCTTCGCTTTGCCGATGATATCGTCATCATGGCGGAATCGCTGCAGAACTTACAAGAAATGGTGCACAGCCTTAATGCTGCATCCCAACGGGTTGGCCTCGGAATGAACTTGGATAAAACCAAGGTAATGTTTAACGGAAACGTCATTCCGAGACCAATCGATGTTGGCGGTACACCTCTCGAAGTTGTTCAAGAGTATGTCTACCTGGGACAGACCCTACAACTAGGTCTTTTCGTCGCCCATACCACAATGTCTGAAGACAAAGGTCTATAA
Protein
MTLATLNTRTLRLDEHIEELEAELGRIRWHVLGLCEVRRQGEDVITLDSGHLFYFREGDQPGQGGVGFLVNKILTDNIIEVSSVSTRVAYLVIKLTERYSLKVVQVYAPTSSYSDDDVEIVYDDITRALHDTTKAHFNVVMGDFNAKVGVQTCDESVLGSFGYGCRNHRGQMLVNFLQRERLFLMNSFFKKKPQRKWTWLSPDTVTKNEIDFIMTDKKHIFRDVSVISRFNTGSDHRLVRGTLNMDFKLERTRLIKSTLRPSLHHMAVDPEQFQLDLHNRFAALETTTDVDEALDGVVRTLRQEGQRLCPKGRTGRTSKLSSETLRLMEERRENTQATQSEKVALNKKIRTLVRRDLRRYNTQRINDAIEQNRGAKVFVQPLGKSHLTKLTKKDGQILASKPEILKELEDFYGGLYTSKATKPVSDPADVRATLSRHYTDELPQISVDEIGMALENLKNGKAPGEDGVTSELLKAGGLPVIRELQKLFNTVLFTGKTPRAWSRSIVVLFFKKGDKTLLKNYRPISLLSHVYKLFSRVITNRLAQRLDDFQPPEQAGFRRGFGTVDHIHTVRQIIQKTEEYNLPLCLAFVDYEKAFDSIETWAVLESLQRCQADWRYIDALRCLYDAATMTVQVQKDQTRPIQLRRGVRQGDIISPKLFTNALEDVFKTLDWNGRGININGEYISHLRFADDIVIMAESLQNLQEMVHSLNAASQRVGLGMNLDKTKVMFNGNVIPRPIDVGGTPLEVVQEYVYLGQTLQLGLFVAHTTMSEDKGL

Summary

Similarity
Belongs to the integrin beta chain family.
Belongs to the monovalent cation:proton antiporter 1 (CPA1) transporter (TC 2.A.36) family.
Feature
chain  Integrin beta
EMBL
FJ265542    ADI61810.1    RSAL01000220    RVE44071.1    FJ265550    ADI61818.1    + More
FJ265545    ADI61813.1    FJ265549    ADI61817.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    FJ265551    ADI61819.1    RSAL01000057    RVE49824.1    RSAL01001818    RVE40675.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    FJ265561    ADI61829.1    JARK01001655    EYB84321.1    FJ265564    ADI61832.1    FJ265562    ADI61830.1    JARK01001351    EYC23458.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001354    EYC21713.1    JARK01001370    EYC16150.1    GBBI01004876    JAC13836.1    JARK01001353    EYC22263.1    GDKW01001596    JAI54999.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    ODYU01008249    SOQ51673.1    JARK01001337    EYC34625.1    EYC16376.1    GBBI01004877    JAC13835.1    JARK01001711    EYB81734.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    EYC21986.1    FJ265563    ADI61831.1    JARK01001438    EYC02111.1    JARK01001730    EYB81048.1    JARK01001415    EYC05858.1    JARK01001543    EYB91356.1    JARK01001462    EYB98944.1    JARK01001395    EYC09730.1    EYC09729.1    JARK01001505    EYB94618.1    JARK01001736    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    EYB94617.1    JARK01001459    EYB99276.1    JARK01001435    EYC02496.1    EYB99275.1    JARK01001359    EYC20105.1    DS268591    EFO92565.1    JARK01000343    EYC38099.1    JARK01000109    EYC42952.1    EYC33297.1    JARK01000302    EYC38674.1    JARK01001475    EYB97550.1    JARK01000063    EYC44387.1    JARK01000132    EYC42415.1    JARK01001344    EYC28216.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001421    EYC04912.1    JARK01000008    EYC46079.1    JARK01001357    EYC20551.1    JARK01001497    EYB95322.1    JARK01001389    EYC10874.1    JARK01001401    EYC08686.1    JARK01001340    EYC30744.1    JARK01001621    EYB86109.1    EYC03125.1    JARK01001372    EYC15614.1    JARK01000161    EYC41641.1    JARK01000460    EYC36749.1    JARK01001407    EYC07212.1    EYC30828.1    JARK01001581    EYB88505.1    JARK01000802    EYC34990.1    DS268444    EFP01729.1    JARK01001612    EYB86585.1    JARK01001500    EYB95049.1    JARK01001626    EYB85833.1    JARK01001524    EYB92970.1    JARK01001582    EYB88498.1    DS270843    EFO97547.1    JARK01001618    EYB86258.1    JARK01000078    EYC43871.1    JARK01001531    EYB92324.1    JARK01001346    EYC26445.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF13520   AA_permease_2
PF00362   Integrin_beta
PF03372   Exo_endo_phos
PF10328   7TM_GPCR_Srx
PF00999   Na_H_Exchanger
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR020846   MFS_dom       
IPR002293   AA/rel_permease1       
IPR032695   Integrin_dom_sf       
IPR036465   vWFA_dom_sf       
IPR015812   Integrin_bsu       
IPR002035   VWF_A       
IPR002369   Integrin_bsu_VWA       
IPR016186   C-type_lectin-like/link_sf       
IPR016187   CTDL_fold       
IPR001507   ZP_dom       
IPR019430   7TM_GPCR_serpentine_rcpt_Srx       
IPR017452   GPCR_Rhodpsn_7TM       
IPR018422   Cation/H_exchanger_CPA1       
IPR006153   Cation/H_exchanger       
IPR004709   NaH_exchanger       
SUPFAM
SSF56219   SSF56219        + More
SSF53300   SSF53300       
SSF69179   SSF69179       
SSF56436   SSF56436       
Gene 3D
PDB
6AR3     E-value=7.80499e-06,     Score=121

Ontologies

Topology

Subcellular location
Membrane  
Length:
775
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00762000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00026
outside
1  -  775
 
 

Population Genetic Test Statistics

Pi
165.429525
Theta
63.056641
Tajima's D
1.612305
CLR
29.680749
CSRT
0.809659517024149
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号