SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09446
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.912
 

Sequence

CDS
ATGTTGCGTTTTGCAGGATCGTTTTGTTATTATTACAGTAGATTGGGGGGAATAGAAACTAGAGTTAGATTAGAGACAAATCTCCCTGGGGGACCGGCTTTCCCCCTGGGGGACCGGCTCCTTGAGCTATATAATGGCTGCTTGGAGTCGGGACGGTTTCCGTCGCTCTGGCGGACGGGTAGACTTGTGTTGTTGAGGAAGGAGGGGCGCCCGGTGGATACAGCCGCCGGGTATCGTCCTATCGTGCTGCTGGACGAGGCGGGAAAATTGCTGGAACGTATTCTGGCTGCCCGCATCGTTCGGCACCTGGTCGGGGTGGGGCCTGACCTGTCGGCGGAGCAGTACGGCTTCCGGGAGGGCCGTTCGACCGTGGATGCAATTCTTCGCGTGCGGTCCCTCTCGGACGAGGCCGTTTCTCGGGGTGGGGTGGCGCTGGCGGTGTCTCTTGACATCGCCAACGCATTTAACACTCTGCCCTGGACCGTGATAGGGGGGGCACTGGAGAGGCATGGAGTGCCCCTCTACCTCCGCCGGCTGGTTGGGTCCTATTTGGGGGCCAGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCCTTTCGTGCTCACTTTGCGGAGCTGGTCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGTCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTCTTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTTCGTGCTCGGGGCGTGGCGCGTGTCCCCGAGAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTAGCCAACCCCACGTGGGGGCTACGGACCGTCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAGGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTCACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MLRFAGSFCYYYSRLGGIETRVRLETNLPGGPAFPLGDRLLELYNGCLESGRFPSLWRTGRLVLLRKEGRPVDTAAGYRPIVLLDEAGKLLERILAARIVRHLVGVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSRGGVALAVSLDIANAFNTLPWTVIGGALERHGVPLYLRRLVGSYLGARGRGAVEVPRPRVGQPVGLSCSLCGAGPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPESELRARKAHSRRSVLESWSRRLANPTWGLRTVEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCHHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

Pfam
PF07776   zf-AD        + More
PF00078   RVT_1
PF00096   zf-C2H2
PF14529   Exo_endo_phos_2
Interpro
IPR012934   Znf_AD        + More
IPR013087   Znf_C2H2_type       
IPR000477   RT_dom       
IPR036236   Znf_C2H2_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF57667   SSF57667        + More
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0355702,     Score=88

Ontologies

Topology

Length:
506
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02805
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00184
outside
1  -  506
 
 

Population Genetic Test Statistics

Pi
148.8845
Theta
4.866195
Tajima's D
1.53558
CLR
257.347421
CSRT
0.814259287035648
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号