SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09421
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.115 Nuclear   Reliability : 1.018
 

Sequence

CDS
ATGGGCGCGCCGCCACGGGGTGATGTGAGCGGTGATGCCCCTGCTGAGGTGGTCCCTCCGAGTATCTCGGAGGAGGAGATTCGTGCGGCCGTGTCGAGGATGCGGAGGAAGGACGCGGCCCCCGGCCCTGACGGTGTTCATGGTCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGGCTCGTGCGGCTCTTTGAAGCCTGCCTCGAGTCGGGACGGTTTCCGAAACAGTGGAAGACGGGCAGACTTGTTTTGCTGAGGAAGGAGGGACGCCCTGCAGACTCACCTGCGGGGTACCGTCCAATCGTGTTGCTGGACGAGGCGGGAAAACTGCTCGAGCGAGTGGTGGCCGCCCGCATCGTCCAGCACTTGGCGGGGGTGGGTCCCGATCTGTCAACGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATCGACGCGGTGATGCGCGTGCGCGCCCTCTCTGATGAGGCTGTCGGCCGGGGCGGGGTTGCACTGGCGGTGTCCCTGGACATCGCCAATGCGTTCAACACCCTGCCCTGGTCGGTGATCGCAGGGGCGCTGGAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGACAGGTCGGTCATGTGCACCGAGCACGGTGGGGCGGTGCTCCGCTTCCCCGTCGAGCGCGGTGTCCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGTGCCCTTAGCGCTCCTCTCCCGGGTCTAAGCGTAGTTTGTTACGTGGACGACACCTTGGTCGTGGCCCGGGGTAGGGACTTGCGCGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGGCCTTCGTCGTCGGCAGGATCCGAAGGCTGGGTCTGGAGGTGGCGTTCGATAAATCCCAGGCCCTGTTGTTCCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCGACCGGGTTGCGCCGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGTCCCGACATGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCAATGGCACTGTACGGGGCGCCCGTATGGTGCCACGCCCTGACCCGTGACAACGTCGCAGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGGTACCGCACCGTCTCGTTCGAGGCGGCGTGCGTGCTCGCCGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTTGCTGCGGATTACGCGTGGCGATGTGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGCGCGGCGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCATTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTGCTGCCCCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTGCGATGCTCGGCAGCGATGAGTCCTGGCAGGCGATGCTCGACTTCTGCGTGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAACTCTTCCTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGGTCGGAGGAGGGCGTTTGTCCAGCTCCGGCCCCTATGA
Protein
MGAPPRGDVSGDAPAEVVPPSISEEEIRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLFEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLAGVGPDLSTEQFGFREGRSTIDAVMRVRALSDEAVGRGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVMCTEHGGAVLRFPVERGVPQGSVLGPLLWNIGYDWVLRGALSAPLPGLSVVCYVDDTLVVARGRDLRESARLSCAGVAFVVGRIRRLGLEVAFDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRRRLAESAVAERRGPDMVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLACCPAFAEQRRVLVAKIGPDLSLPTVVAAMLGSDESWQAMLDFCVSTISQKEAAERERENSSSLSAPCRRRRAGGRRRAFVQLRPL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    D85594    BAA19776.1    RSAL01003504    RVE40273.1    RSAL01000481    RVE41577.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    LBMM01006657    KMQ90417.1    LBMM01006063    KMQ90967.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01005733    KMQ91252.1    LBMM01007425    KMQ89740.1    LBMM01008448    KMQ88867.1    LBMM01002052    KMQ95336.1    LBMM01005948    KMQ91066.1    LBMM01008682    KMQ88705.1    LBMM01004634    KMQ92224.1    LBMM01002480    KMQ94776.1    LBMM01015018    KMQ84954.1    LBMM01003679    KMQ93242.1    GGMR01014195    MBY26814.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01006725    KMQ90373.1    LBMM01012412    KMQ86235.1    LBMM01019839    KMQ83438.1    LBMM01008278    KMQ89009.1    ABLF02011238    LBMM01015025    KMQ84953.1    LBMM01019838    KMQ83439.1    KMQ94772.1    LBMM01014122    KMQ85315.1    LBMM01003988    KMQ92922.1    ABLF02014378    LBMM01005465    KMQ91492.1    GGMR01015159    MBY27778.1    LBMM01004505    KMQ92346.1    LBMM01003575    KMQ93366.1    LBMM01008422    KMQ88894.1    LBMM01005474    KMQ91485.1    GGMR01000779    MBY13398.1    LBMM01003245    KMQ93755.1    GGMR01011682    MBY24301.1    GFXV01002090    MBW13895.1    KU543683    AMS38371.1    LBMM01006977    KMQ90149.1    ABLF02059310    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GGMR01004600    MBY17219.1    ABLF02041886    GFXV01003903    MBW15708.1    ABLF02016340    GAKP01002292    JAC56660.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    LBMM01004262    KMQ92649.1    LBMM01004261    KMQ92650.1    GALA01001777    JAA93075.1    LBMM01014956    KMQ84982.1    LBMM01005216    KMQ91703.1    ABLF02034925    GGMR01006838    MBY19457.1    ABLF02023257    ABLF02041557    LBMM01015285    KMQ84870.1    AB593325    BAK38646.1    GGMR01015354    MBY27973.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    GEHC01000964    JAV46681.1    ABLF02009991    ABLF02009992    ABLF02054952    AB593321    BAK38639.1    GALX01004785    JAB63681.1    HACL01000281    CFW94575.1    APGK01005465    KB736249    ENN83233.1    AB090817    BAC57910.1    GGFL01004046    MBW68224.1    ABLF02021100    KQ971309    EEZ99146.1    KQ972691    KXZ75806.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF07776   zf-AD
PF00096   zf-C2H2
PF00098   zf-CCHC
PF13966   zf-RVT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR026960   RVT-Znf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=4.47172e-05,     Score=114

Ontologies

Topology

Length:
629
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0380300000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00089
outside
1  -  629
 
 

Population Genetic Test Statistics

Pi
0.420595
Theta
0.160657
Tajima's D
0.007465
CLR
227.537886
CSRT
0.76081195940203
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号