SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09420
Annotation
S33901_reverse_transcriptase_-_silkworm_transposon_Pao
Location in the cell
Nuclear   Reliability : 3.295
 

Sequence

CDS
ATGCCGATAACGCGGTCAACAGGAAGAGGACGGATCGAAACTGAACAGTCGCCGCCCTCAGAAACCACAGCTACAACACAGAGCATGTGGACAGAAACAACCGCGAATACCGTCATGAGTCTGGTAGCCCCCACAACAGAATCATCGTGCGCAACAGCCAACACGGAAGCCACGACGAAACTCGCAGAGAAACCTGGGAACTCAAAAACAGAGGCCGTCAAACAGTATATAGCCAAACAGAATGACGTGCCAACAAAACAGCGCACCGGTACAGTCAAAACTGACCGGTCGCGAAACAGAAAAGAACAGAAGATAGCCAAAGCTAGAGAAGAGCTCGCCCGCCTACAGGTGGAGTTAGCAGCCGCCCGATTGGCCACGCTCGAAGCTGGATCTGATGACGAAAACAGCGAATCAGAATACAGTAAAGAAATTACACGCAGAGTTGCTCTGAGAAAGAAAAATAATCCTGTGGACATAAATGACGCGGAATTCAAAAATAGATACCGGTTGAATAAAGAATCATTCAAGTTTCTTTGTAATCAACTTAAGCAAAAAACATCTTTAAAAGCAAGTTCCAGGATAAGTTTGGAACTTAAGGTTCTTTGCGCGCTATCTTTTTATGCCACTGGATCTTACCAACGCTTAGTGGGAATGGCTAAATATTTGGGCCAAACGACTGTAAGCAAATGTGTGAAGGAAGTAACAGATGCTCTTGTAACTCCTGCAATTTTAAATACTTTCATAAAATTTCCTTATGCCAGAGCTGATAGAGATGTAATAAGAAACAAATTTTTTGCAAAGTATGGTTTCCCAGGAGTTATAGGATGCATTGATGGATGTCATTTCCATATTTTCACACCCAAAAAAGAAGTCGAACATTTGTATTATAGTAGAAAGCATTTCCATTCATTAAATGTGCAAATGGTAAGCGCAGCTCCGCCGGCGTGTCCAAATGAAGTAAAATAG
Protein
MPITRSTGRGRIETEQSPPSETTATTQSMWTETTANTVMSLVAPTTESSCATANTEATTKLAEKPGNSKTEAVKQYIAKQNDVPTKQRTGTVKTDRSRNRKEQKIAKAREELARLQVELAAARLATLEAGSDDENSESEYSKEITRRVALRKKNNPVDINDAEFKNRYRLNKESFKFLCNQLKQKTSLKASSRISLELKVLCALSFYATGSYQRLVGMAKYLGQTTVSKCVKEVTDALVTPAILNTFIKFPYARADRDVIRNKFFAKYGFPGVIGCIDGCHFHIFTPKKEVEHLYYSRKHFHSLNVQMVSAAPPACPNEVK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
321
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.3036
Exp number, first 60 AAs:
0.00021
Total prob of N-in:
0.08107
outside
1  -  321
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
190.241372
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号