SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09410
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.538
 

Sequence

CDS
ATGGAGGAAAAACTTTTCATCGACTTCATTCGGGAAAAATATCCGACAATCGCGCCCGAATTCGAAGCCTATAGGGCTTCATTTGGTAAATATTCTCCCCCCGCATCTAACGCCGCCGTCGCCAAACATGCCTCGCAGGCATGCCTCGCGTGCCCCGCCGCCGGTCCGTGTTCAAGCGCACGTACGCACGCCGCCGCCGTAGCGTCTAACGCCCCCGCCCCCGCTACCCCCGCGCCCGCGTCAATCACGTCAGTTTCGTCCGTCGCGACCTCAATAGCGTCTAGTTCAGGCTCCGATACCGAATCGGAGATGGACTTCGAGTCCGCGACTAGCCCTCAACCCGGAACCTCGGATGGGTTCCAAACTGTAACGCGCGGTAAAAAGCGTACTCGCGTCGTGGAGTCCCGGAGCTCCATGACGAAGCAAACCAAGTCCGCGACCGCCTCCCGACCGCAGGTAGTCGTGACGCCGGAGTCGGACTCCGCCCGCCGCGTAACCCCACCGCCGCGCCCAAAAACCGCGCCCGCGCCTAAAACAGTTGTCCCGCCCCCGCTGATACTCCAAGAGAAGTCAGCGTGGAATCGCGTATCCCAGGCCCTTCAGGCCAACAAAATTAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATTAAGGTCGCAACTCCGGGCGACCATAGGGCCCTCTCTGCTTACCTCCGAAAGGAGAACATAGGTTATCACACCTATGCTCTTCAGGAGGACCGCGAACTCCGCGTAGTGATACGCGGAGTCCCCAAGGAACTCGACATAGACTACGTAAAGGAGGATCTGATCGGTCAGTCCCTCCCAATAGTTAGTGTGCACCGGATGCACAGCGGACGCGGCAGACAGCCGTACAATATGATTCTCGTCGCGCTAGAATCAACCCCGGAGGCAAAGAAAAGAATCTCATGTCTCAAAACGATATGCGGCCTCTCCGGGGTCACCATCGAAGCCCCCCATAAACGTGGTACTCCCGGGCAGTGCCACAGGTGCCAGCTCTATGGCCACTCAGCGCCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGACAATCTTGTAGATATTTTGTTAGTGCAGGAGACCTGTCTGAAGCCCTCGCGTCGTGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTAAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACTAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACTTTTGAAGTAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGTGCTTACGTTCCATCGAAGCACTGTCAGAGCTCGACTCAGACCACCGACCTGTCCTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTACTCGAAGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCTATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTATCCTCCGAACTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCCTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTGCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAATCTCCAACCTAGAAAGGCATCCGGCTCCGACGGCATCCGCAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACATCTAGTTACCGTCCGATTAGTCTCCTCCCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCTAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATCCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGTTGCTGCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCAAATACTACTTCGAGCATCCCACTCCCTAATAGGCGCGCAAACACCTCCGCCGTTAGCCCCGTCACTCTCTTTGGCCAGCCCATACCGTGGGCCTCGCAGGTCAAATACCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATTAAGACGGTACGCGACCGTGCCGCCTTCATATTAGGACGTCTCTACCCTATGCTTTGCAAGCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGCATACGCCCCATTATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAGCCCCTTCAGGTTATTCAATCCCGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTGAGGAACGTGGATCTCCACGATGACCTGGAGCTCGACTCTGTCAGTAAGTATCTTCAGTCGGCATCATTGCGCCATTTCGAGAAGGCGGCACGACATGAGAACCCTCTTGTCGTGGCGGCTGGAAACTACATACCCGATCCTGTAGACCGAATGACCGCTATCAATTTAGTTACCGAAGTAAACTTCACATTGTATAATTAA
Protein
MEEKLFIDFIREKYPTIAPEFEAYRASFGKYSPPASNAAVAKHASQACLACPAAGPCSSARTHAAAVASNAPAPATPAPASITSVSSVATSIASSSGSDTESEMDFESATSPQPGTSDGFQTVTRGKKRTRVVESRSSMTKQTKSATASRPQVVVTPESDSARRVTPPPRPKTAPAPKTVVPPPLILQEKSAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGYHTYALQEDRELRVVIRGVPKELDIDYVKEDLIGQSLPIVSVHRMHSGRGRQPYNMILVALESTPEAKKRISCLKTICGLSGVTIEAPHKRGTPGQCHRCQLYGHSAPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLLHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVVGPPTPTCYPYNIALRPSTIDLALLRNVTLCLRSIEALSELDSDHRPVLMQLGRPHNPVTVTRTMVDWNKLGTCLLEAAPPILPYGPDSNLSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSSELRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRAALPPSDALPPITTDEVRDAIHNLQPRKASGSDGIRNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLPTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTSSIPLPNRRANTSAVSPVTLFGQPIPWASQVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCKRSKLSLRNKVTLYKTCIRPIMTYASVVFAHAARTNLKPLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSVSKYLQSASLRHFEKAARHENPLVVAAGNYIPDPVDRMTAINLVTEVNFTLYN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    ABLF02042518    ABLF02057746    GALX01005359    JAB63107.1    GBBI01004395    JAC14317.1    GGMS01002992    MBY72195.1    GBBI01004571    JAC14141.1    RPOV01000134    RPJ78669.1    S59870    AAB26437.2    ABLF02024246    KK119261    KFM75202.1    GFTR01008279    JAW08147.1    KK119692    KFM76444.1    ABLF02008153    ABLF02008462    ABLF02008464    GGFJ01001844    MBW50985.1    GGFL01005012    MBW69190.1    GGFJ01001842    MBW50983.1    GGMS01006359    MBY75562.1    NEVH01011985    PNF31054.1    GGFJ01001843    MBW50984.1    NEVH01006736    PNF36716.1    GGFL01004957    MBW69135.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01021205    PNF19912.1    GGFJ01001858    MBW50999.1    GGMR01003407    MBY16026.1    GGFJ01001857    MBW50998.1    GFTR01008262    JAW08164.1    GFTR01008261    JAW08165.1    GFTR01008271    JAW08155.1    NEVH01017470    PNF24199.1    ABLF02034467    GFXV01000908    MBW12713.1    GGMR01000676    MBY13295.1    GFTR01008251    JAW08175.1    GFTR01008256    JAW08170.1    GGMR01012305    MBY24924.1    GBGD01000415    JAC88474.1    GFTR01008269    JAW08157.1    NEVH01020940    PNF20481.1    NEVH01016302    PNF25823.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GEZM01084969    JAV60363.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGMS01017365    MBY86568.1    M22874    M38643    GFTR01008254    JAW08172.1    GEDC01000337    JAS36961.1    GBGD01000389    JAC88500.1    KU543673    AMS38352.1    NWSH01007753    PCG62823.1    GGMR01016905    MBY29524.1    GGMR01006408    MBY19027.1    GFTR01008257    JAW08169.1    GGFL01005122    MBW69300.1    GGFL01005121    MBW69299.1    GFTR01008260    JAW08166.1    GECL01003538    JAP02586.1    GGMR01000226    MBY12845.1    AY060438    AAL25477.1    GGMR01016296    MBY28915.1    GFXV01002840    MBW14645.1    M38437    DNOY01000259    HBE18313.1    NEVH01019963    PNF22185.1    GGMR01012283    MBY24902.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00575609,     Score=98

Ontologies

Topology

Length:
1263
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.331930000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1263
 
 

Population Genetic Test Statistics

Pi
136.697909
Theta
133.99049
Tajima's D
0
CLR
162.789969
CSRT
0.364081795910205
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号