SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09402
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
PlasmaMembrane   Reliability : 1.062
 

Sequence

CDS
ATGAGCCGTAAGCTCGTAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTGCTGGACTGGATGACTCCGTGACCTCTGAGGAGGTGGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGCGATATACGCACCGATGCCACCGGACTCGGCGTGGTCTGGGTTCGGTGCCCTGTAGCGTCGGCGAAAAAGATCGCCTTAAGCGGCAGATTGCTGGGCAATATCAATCACTGTGCCAGAGCTCAGGATATTTTACTCCAGAGCATGGCAGAGTGGTCGATCCACGTGGCTGCGGTCGCCGAACCGTACTTTGTCCCCGCCCGTGACAACTGGCTGGGGAGCATTGACGGCTTGGTGGCCATTATCGGCCAGACTCTGATCAACCCGTCTCGGGGCCGCGGCTGGGTTGCTGCGGTCTCGGACGGTATCGGCATTGTAGGGGCGCCGCTATCACCCTCGTCCCGTTCTGGTGCTCGGGATCTCAACGCCAAGTCATCGGCGTGGGGATCTCCGGTCACTGACCATCGGGGCGAGGTGCTAGAAGAGTGGGCGGTGACAACTGGTCTGGTCGTCCTGAATCGGGGTTCGGAATACACGTGCGTGCGGCAGCGGGGCGGCTCGATAGTGGACGTCTCGTTTGCTAGCCCCTCTGTCGCCAGCCGAGTCCGCGACTGGCGTGTCGCCGTGGAGGTGGAGACGCTGTCGGACCATCGGTATATCCGGTTCGACGTCTCTGCCCAGACCGCGAGCGGCCGCCAGCCAACCGCCCCGATTAACGACGGCCCACGCTGGGCACTTAAGCGCATCGACGAGGAGCTACTCGAGGAAGCTGCCTTAGTCCAGTCCTGGATTTGGGAGTCGACAATGAACAGTCCCGTCGACGTCGAAGCGGTGGCGCTGTGGTTTCGAGGGGCGATGACGCAGATCTGCGACGCGTCCATGCCCCGTGTCCACCAACAGTCCGCAAGGCGCCAGGTGTACTGGTGGACCGACGAGATCGCGCGGCTGCGCGTTGAGTGCGTCGCGGCTCGCCGCCGGTACACGCGATACCGGAGACGACGTCGACGGGATTCCGTCGAGGAAGACGCGCTGTATGAGGCGTACCGCGCGTCTAAGGAGACTCTGTGGCTGGCCATCGGCGACTCTAAGTCGCGTGCCAGGGAGGAGCTGCTGGGGTCCCTAGATCGGGATCCGTGGGGGCGCCCCTACCGTTGGGTACGGGGCAAGTTGCGTGCCTGGGCGCCTCCACTGGCGCAAAGCATGCAACCCCAGTTGCTAGAAGCGGTTGTATCGGCCCTCTTCCCTGAGCGAGCGGAATACGTTTCCCCGGCGATGGCTTCACCCTCAGCCACAGACTCTCGAGAAGAGGAAAGCACCGATGTCCCCGAGGTGACGCAAGCAGAAATGAGAGCGGCCGTGTCGCGACTCCGGTCTAAGAACACGGCCCCGGGACCCGACGGAGTTCCTGGTCGAGCACTCGTCCTGGCTCTGAAGGAGCTAGAGCCCCAGCTGAGGGGGCTCTTTACGGCATGTCTCGAGCAGGGTCAGTTTCCTAGTGTATGGAAGGAGGGGAAGCTGGTCCTGCTCAGGAAGGAGGGGCGCCCCGCGGACTCGCCGTCCGCGTATCGGCCCATAGTGCTGCTCGATGAGGCGGGCAAACTTTTTGAGCGCATTATCGCAGATCGCCTCGTCAGCCACTTGTGCAGGGAGGGGCCGGACCTGGATGACAACCAATTTGGTTTTCGTCGGGGGCGCTCCACCATAGACGCCATCATGCGCGTGAGGGCCCTGGCGGAGGAGACGGTGTCCCGGGGTGGGGTGGTACTGGCGGTGTCTTTAGACATCTCCAACGCTTTCAACACCCTACCCTGGAGTTGTATTCGGGAGGCTCTGAAATACCATCGCGTGCCTCCCTACCTCCGCCGCACGGTAGGGGCTTATCTGGAGGGTAGATGCGTCACTTATCGGGGACGTGACGGTGCCGGTCGGCACCTCATGTCGTGCGGTGTTCCACAGGGATCGGTCTTGGGACCGCTCCTGTGGAACATCGGCTACGACTGGGTGCTGAGAGGCGAGCTCCCGTCGGGCGCCAACTTGACGTGTTATGCGGACGACACGCTTGTCACTGCCCGGGGGAGCTCGCACAGGGAAGCGACGTTGATAGCCGCGGCTGCGGTGTCACTGGTGGTGAACCGCATCCGGCGCCTGGGCCTGGAGGTGGCCCTAAACAAGTCGGAGGCTATGGTGTTTCATGGCCCCCGACGTGCGCCGGCGCCGGGATCACACATCGTGGTAAGTGGGACCCGGATAGCTGTCGAGTCCACCATGAAGTATCTGGGATTGGTGCTCGACAGCCGATGGGAATTCGGGCCCCACTTCCGGCGGCTGGTGCCCAAGCTGATGGGTGCAGCGGGCGCGCTTTCAACGTTGCTTCCCAATTTGGGGGGCCCGAGCGCCGCCTGTAGGCGGTTGTACGTGGGAATCGTGCGGTCCATGGCCCTGTATGGGGCCCCTGTGTGGGCGATGGACATGACGGCCAGCACACTCGCCATTCTGCGTAAGCCGCAGAGGGTGATGGCCGTCAGAGTCATCCGCGGGTACCGCACGATTTCCTACGAGGCGGCTTGCGTCCTGGCCGGATCCCCGCCCTGGGACCTAGAGGCGAAAGTACTCGCGTCATTATATCGATGGCGCGAGGAAGAGCGGGCACGGGGCTCGAGGCTGGTGCAGCGGCAGATCGCGCTGCGCCGAGAGGAGCTCCGTCTGGCCTTGGTGGCGGAATGGCGGCAAAGGCTTCTGCGCCCTACCGCCGGCCTCGCAACCGTCGAGGCGATCCGGCCAGTACTCGACGACTGGCTCGGGAGAAGGCACGGATCCCTGTCGTTTAGGGTGACACAGGTGCTGTCGGGGCACGGTTGCTTCGGCAAGTACCTGTGCCGCATAGACAGGGAGCCGGACGCTCGGTGCCACCACAGCGTCCACTGCGGGGAGGACACGGCGCAACACACGCTCGCCGAGTGTGTAGCTTGGGAGGAGCAGCGCCGTGTCCTCACAAATGAAGTAGGAAGCGATCTGTCGCTGCCGGCCGTAGTGCGGAGGATGGTCGGCAGCGCAGAGTCGTGGGACGCGGTGGTGTCCTTCTGCGAGGACGTGATGTCGCAGAAGGAAACTGCAGAACGGGAGAGGGAGATCTCGACTCCCTTTCCCGGCCGCAGAAGGCGCACCGGGCGCAGAACAAGGGCGGACAATGCCCTTTTCCGCCCCCCATGA
Protein
MSRKLVKADALAAKMREVLSPEDVRVSRPMKTAEVRIAGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATGLGVVWVRCPVASAKKIALSGRLLGNINHCARAQDILLQSMAEWSIHVAAVAEPYFVPARDNWLGSIDGLVAIIGQTLINPSRGRGWVAAVSDGIGIVGAPLSPSSRSGARDLNAKSSAWGSPVTDHRGEVLEEWAVTTGLVVLNRGSEYTCVRQRGGSIVDVSFASPSVASRVRDWRVAVEVETLSDHRYIRFDVSAQTASGRQPTAPINDGPRWALKRIDEELLEEAALVQSWIWESTMNSPVDVEAVALWFRGAMTQICDASMPRVHQQSARRQVYWWTDEIARLRVECVAARRRYTRYRRRRRRDSVEEDALYEAYRASKETLWLAIGDSKSRAREELLGSLDRDPWGRPYRWVRGKLRAWAPPLAQSMQPQLLEAVVSALFPERAEYVSPAMASPSATDSREEESTDVPEVTQAEMRAAVSRLRSKNTAPGPDGVPGRALVLALKELEPQLRGLFTACLEQGQFPSVWKEGKLVLLRKEGRPADSPSAYRPIVLLDEAGKLFERIIADRLVSHLCREGPDLDDNQFGFRRGRSTIDAIMRVRALAEETVSRGGVVLAVSLDISNAFNTLPWSCIREALKYHRVPPYLRRTVGAYLEGRCVTYRGRDGAGRHLMSCGVPQGSVLGPLLWNIGYDWVLRGELPSGANLTCYADDTLVTARGSSHREATLIAAAAVSLVVNRIRRLGLEVALNKSEAMVFHGPRRAPAPGSHIVVSGTRIAVESTMKYLGLVLDSRWEFGPHFRRLVPKLMGAAGALSTLLPNLGGPSAACRRLYVGIVRSMALYGAPVWAMDMTASTLAILRKPQRVMAVRVIRGYRTISYEAACVLAGSPPWDLEAKVLASLYRWREEERARGSRLVQRQIALRREELRLALVAEWRQRLLRPTAGLATVEAIRPVLDDWLGRRHGSLSFRVTQVLSGHGCFGKYLCRIDREPDARCHHSVHCGEDTAQHTLAECVAWEEQRRVLTNEVGSDLSLPAVVRRMVGSAESWDAVVSFCEDVMSQKETAEREREISTPFPGRRRRTGRRTRADNALFRPP

Summary

EMBL
AB078931    BAC06456.1    AB078929    BAC06452.1    AB078930    BAC06454.1    + More
AB078935    BAC06462.1    AB090825    BAC57926.1    D85594    BAA19776.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    AB078936    BAC06464.1    LBMM01004272    KMQ92618.1    RSAL01003504    RVE40273.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01007036    KMQ90099.1    LBMM01015025    KMQ84953.1    LBMM01002052    KMQ95336.1    LBMM01008448    KMQ88867.1    LBMM01003988    KMQ92922.1    LBMM01008422    KMQ88894.1    LBMM01006657    KMQ90417.1    LBMM01004634    KMQ92224.1    LBMM01012412    KMQ86235.1    LBMM01015285    KMQ84870.1    LBMM01014122    KMQ85315.1    LBMM01007425    KMQ89740.1    LBMM01008278    KMQ89009.1    LBMM01008445    KMQ88871.1    LBMM01004262    KMQ92649.1    GGMR01015159    MBY27778.1    LBMM01005474    KMQ91485.1    LBMM01006977    KMQ90149.1    ABLF02011238    LBMM01002480    KMQ94776.1    ABLF02034925    GFXV01002090    MBW13895.1    GAKP01002292    JAC56660.1    ABLF02013358    ABLF02013361    ABLF02054869    LBMM01004261    KMQ92650.1    LBMM01005465    KMQ91492.1    GGMR01006838    MBY19457.1    GFXV01003903    MBW15708.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGFJ01001369    MBW50510.1    LBMM01004505    KMQ92346.1    ABLF02041886    GGFJ01001439    MBW50580.1    KU543683    AMS38371.1    GALA01000302    JAA94550.1    GGFJ01001370    MBW50511.1    GALA01001776    JAA93076.1    GALA01001777    JAA93075.1    GGFK01005660    MBW38981.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    KU543679    AMS38363.1    GGMR01004600    MBY17219.1    GGFL01004044    MBW68222.1    AJ278684    CAB99192.1    LBMM01009610    KMQ87992.1    GGFJ01001727    MBW50868.1    ABLF02009073    ABLF02030702    ABLF02042963    AB593321    BAK38639.1    GGFJ01001453    MBW50594.1    AB593327    BAK38648.1    ABLF02023257    GGFJ01001454    MBW50595.1    AB593325    BAK38646.1    ABLF02018808    KQ971309    EEZ99146.1    GGMR01012748    MBY25367.1    KU543682    AMS38369.1    AB090815    BAC57906.1    ABLF02007989    ABLF02011183    ABLF02041884    ABLF02014650    KQ971675    KYB24771.1    KQ972691    KXZ75806.1    AB593323    BAK38643.1    LBMM01006996    KMQ90130.1    ABLF02018942    ABLF02041885    ABLF02041557    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    KQ972544    KXZ75869.1    GFTR01008427    JAW07999.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR021896   Transposase_37       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=0.000144533,     Score=112

Ontologies

Topology

Length:
1115
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.567789999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00190
outside
1  -  1115
 
 

Population Genetic Test Statistics

Pi
13.247483
Theta
41.123103
Tajima's D
3.154234
CLR
13.405601
CSRT
0.986000699965002
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号