SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09401
Annotation
PREDICTED:_uncharacterized_protein_LOC105380908_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.024
 

Sequence

CDS
ATGAACTTGCGTGTTTATATACATTTTGTAGGGACACCGGACATTATGGCGATCTCGCTATCGACACGTATACCAGAATTTTGGACAGAGCAACCAAGAGCATGGTACATTAGGATCGAGTCTATACTCGCCCCACAGAAACTTGGGGATGAAGTTAAATTTGACATTGTCGTATCGAAATTACCAAAAGAAGTCATTATTCAACTAACGGATTTTCTAGCTAAGCCACCGGACACAGGAAAATTTCTGGCGTTAAAAACGAAATTATTATCAACATTTGAGGAGTCCAAAAGTCGACAAATTGAAAGACTCATAGGAGAGATGGAACTAGGAGATCAAAAACCTTCTCAGCTATTGCGCCGCATGAGAGAGTTAGCCAGAGATAAAGTACCGGACGACACCCTGCGAGTGTTATGGCAAGGTCACTTACCTACAACATTGAGGGCAATCCTTACAGTCACTGAAACAAAAGATTTAGACAACCTCGCCATGATTGCGGATAATGTTGCGGAGGCCACGCGAGTTAACCACATCTCTGAGGTCGTTAATCAGCAAACCTCGAATATGGAACGACCATCAACAAGCGACACGTCTTTAATTTTAGCGGAAATAGCAAAATTAAGCGTCAGAATGACTAACATGGAGCAGTCACGATCCAGACAAAACTACTTTGATCGTAACCGTGATAGAAGTGGCTCACGATCTTCATCAAGACGCCGTACCCCACAGAACCCCAACTGGTTATGTTACTACCATTACAAGTTCCGTCAGAATGCTCAGAAATGCGTCCAACCATGTGCATGGAAACCAAGTTCGGAAAACTAG
Protein
MNLRVYIHFVGTPDIMAISLSTRIPEFWTEQPRAWYIRIESILAPQKLGDEVKFDIVVSKLPKEVIIQLTDFLAKPPDTGKFLALKTKLLSTFEESKSRQIERLIGEMELGDQKPSQLLRRMRELARDKVPDDTLRVLWQGHLPTTLRAILTVTETKDLDNLAMIADNVAEATRVNHISEVVNQQTSNMERPSTSDTSLILAEIAKLSVRMTNMEQSRSRQNYFDRNRDRSGSRSSSRRRTPQNPNWLCYYHYKFRQNAQKCVQPCAWKPSSEN

Summary

EMBL
NWSH01000589    PCG75479.1    ODYU01007352    SOQ50042.1    ODYU01000815    SOQ36165.1    + More
BABH01022003    KZ150191    PZC72412.1    GDQN01003070    JAT87984.1    JTDY01001300    KOB74269.1    JTDY01000162    KOB78510.1    NWSH01001424    PCG71274.1    JTDY01004351    KOB68269.1    KOB74268.1    JTDY01000325    KOB77690.1    JTDY01005998    KOB66385.1    ACPB03012735    ACPB03016217    ACPB03034542    ACPB03011651    KZ150227    PZC72038.1    GAKP01020775    JAC38177.1    LBMM01012923    LBMM01012917    KMQ85926.1    KMQ85930.1    GBHO01005513    JAG38091.1    GEZM01036621    JAV82564.1    KK111495    EZA46390.1    LN877232    CTR11709.1    LKEX01009256    KYN50060.1    KQ979024    KYN24351.1    LBMM01013103    KMQ85816.1    KQ978645    KYN29457.1    KL367519    KFD66946.1    KL363221    KFD53012.1    KL367547    KFD64927.1    IAAA01053498    IAAA01053499    LAA11042.1    KQ977516    KYN02153.1    NWSH01003151    PCG66856.1    LBMM01009142    KMQ88358.1    KQ971745    KYB24749.1    GEZM01019580    GEZM01019578    JAV89619.1    GG695519    EFA13383.1    KQ438276    KOX67256.1    KQ971759    EFA12902.2    KQ980726    KYN14011.1    KL367475    KFD72824.1    ACPB03037918    LBMM01012479    KMQ86203.1    KQ981301    KYN43041.1    GEDV01001795    JAP86762.1    LHQN01021927    LHQN01025379    KOC58628.1    KOC58659.1    LBMM01012633    KMQ86093.1    CH902629    KPU75574.1    GEZM01017686    JAV90494.1    KQ971355    EFA07205.2    GBHO01008962    JAG34642.1    GFTR01003955    JAW12471.1    KQ973343    KXZ75568.1    CH905996    KPU81830.1    KK107653    EZA48265.1    KQ981018    KYN10257.1    KQ414987    KOC58988.1    LKEY01014428    KYN50445.1    LBMM01018089    KMQ83878.1    AAZX01005103    KQ435803    KOX73067.1    AAZX01005161    LBMM01012075    KMQ86422.1    QOIP01000006    RLU21744.1    KQ976959    KYN06793.1    KQ435204    KZC15052.1    NWSH01002598    PCG67884.1    GEZM01010484    JAV94030.1    JXUM01002162    JXUM01153874    KQ571812    KXJ68106.1    LBMM01007548    KMQ89630.1    GFWV01009909    MAA34638.1    JXUM01111110    KQ565471    KXJ70931.1    KL367631    KFD61211.1    KQ979048    KYN23218.1    MRZV01001127    MRZV01000236    PIK40395.1    PIK54731.1    KQ435794    KOX73840.1    GBRD01015841    JAG49985.1    JXUM01074757    KQ562849    KXJ75012.1    KQ434816    KZC06854.1    KL363205    KFD54740.1    JXUM01049417    KQ561603    KXJ78027.1    KQ422353    KOF75032.1    MRZV01001674    PIK36447.1    GEHC01001129    JAV46516.1   
Pfam
PF10551   MULE        + More
PF00078   RVT_1
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF00665   rve
PF17919   RT_RNaseH_2
PF17906   HTH_48
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR018289   MULE_transposase_dom       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR034132   RP_Saci-like       
IPR041426   Mos1_HTH       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
274
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13026
Exp number, first 60 AAs:
0.12995
Total prob of N-in:
0.03655
outside
1  -  274
 
 

Population Genetic Test Statistics

Pi
287.334778
Theta
45.958854
Tajima's D
4.870756
CLR
3.863309
CSRT
0.999950002499875
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号