SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09400
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.485
 

Sequence

CDS
ATGGCGTCTCCGGTCGCAGCGACAGACTTAACAACTTTTTCGTCGCCACCCTCACATTTACGTATCCCACCTTTTTGGCCTGAAAAACCTGCTATATGGTTCGCTCAAATTGAAGGACAGTTTGCAGTAATGCGTATAACCGATGATGCGACCAAATTTTACCACATCTTGAGTACCTTAGACAGGCAGTATGCAGCCGAAGTTGAAGACATTCTTACCGGCCCACCTGACTACAATCGACTCAAAGATGAGCTCATCAAGAGACTATCAGTGTCGCGGGAGAATAAGGTGAAGCAGTTGCTCATGCACGAACAGCTCGGAAGCCGCAAGCCTTCACAATTCCTACGGCACCTGCAACATCTCGCTGGCCCCGGAATACCCGAGGACTTCGTTAAAACAATTTGGACAAGCCGTCTACCCACTGGATTGCAGCCAATCATCGCTTCGCAGCCATCGTTGTCTCTCGACGCACTGGCGGAACTTGCCGACCGGGTCAATGACATCGCGACCCCGGTACCGCAGGTAGCAAGCGCTACCACCTCTACGCATATCGACGAGCTGACACGACAGGTAGCAGAGCTGACAAAACAAGTGAGTGCACTGACCGCGCAAATCAACCATCACCCAAGCAGAGGACAACGGAGACCGACAAAGCAACAGCGCAGCAGATCTTCATCTCGCCGCCGATCACAGTCAAACTACAGACAGCACCCCATATGTTGGTATCACTTCAGATATGGTACCAAAGCCGTCAGATGTATCCAGCCGTGCGATTACAAGGCGTTGGAAAACAGTCAACAGTCCGGGCAGTCGCTGATGGCGACACAAGACTGCCGCAACACCACGGGTCGCCTCTTCATCACGGACAGTAAAACTAAAAATCAATTCCTTATTGATACCGGTAGTGATATTTGTGTCTACCCAGTGTCCGCACTTCGAGAGCGTCGTTATAAAACCTCTTTTCAACTGAGTGCCGCGAATGGTTCAGTGATAGATACGTATGGATATATCGAACTTAATCTTAATTTAGGTTTACGTCGTGACTTTCCATGGCGCTTTGTTGTTGCTGATGTCACGATGGCTATTATTGGTGTTGATTTTCTTTCTCATTACAACCTTATTGTTGACATCAGCAACCAACAACTTATTGATACTTTAACCAATCTTAAGTTTGTAACATCTATATGTAAAAATAATTGTCTTGTCACAAGTGTAAAAATTCCAACTGGTGGTAGTGGTAGGTATCACAATATTTTAGCACAATATCCGGAAATAACTCGCCCCGCTGGTACTCCGGGTATCGTCAGACACCACACGACACACCACATCATCACCACACCAGGTCCACCTGTATCGCTGCCGCCCCGTCGTCTCGCTCCAGATAAATTGAGAATCGCCAAGCAGGAGTTCGATGCCATGCTACGTAACGGCACGGCACGCCCTTCCTGCAGTCCTTGGGCATCACCACTGCATCTGGTGTCGAAAAAAAAAGACGACGGCTGGCGTCCATGTGGCGACTACAGGTCAGCCCAGGAGCACGAAGACCACCTGCACCAACTCTTCACACGCATGAAAGAGTATGGCGTTTTGGTTAATACTACCAAATGTGTCTTCGGCGTCCCAGAAGTCACGTTTTTGGGTTATCAAATTTCCGAAAAAGGTACCAAGCCTTTGGTAAGCAAGGCCGAGGCAATCGCAAAATTTCCGGTCCCGAAAACCGTCAGAGAACTCCGGCGATTTTTGGGCATGATTAATTTTTATCGCCGATTCCTACCCAATGCTGCCCAGATACAAGCGCCTCTCAACGCATTGCTGGTTGGTTCCGTAAAAGGTGCACAACCCGTAGTTATCGAGGGAAAGTCATTGCAAGCCTTCCAAGACTGCAAAACCAGCCTATGCAATGCAGCTCTCCTAGCCCATCCCGATACTCAAGCAAAGTTGAGTCTCGTGACAGACGCTTCGGACTCTGCAATAGGTGGAGTACTCCAGCAGCTTAAAGGTGGAGATTGGCAGCCGTTAGCATTTTTCTCTCGTAAATTGAGCCCCTCGCAGTCAAAATACTCGCCCTACGACCGAGAGCTCCTCGCCATTTATGAGAGCATAAAATACTTCCGGCATATGCTTGAAGCAACAAATTTTACTGTGTATACTGACCACAAACCTTTATGTTATGCATTTCAGCAGCCGAAGCATAACTGTTCGCCGCGTCAGTACAGACATCTGGACTTCATTTCCCAGTTCACCACGGACATAAGGTTTGTTTCGGGCAAAGACAACCTTGTCGCTGACACCTTGTCTCGCATCTGTGAACTGCAGATGCCTGTGGACTTGGAAGAAATGGCCAAGCTACAAACCACAGATCCGGAGCTGGCAGAACATTTATCGGGTGGAACCTCTTTACGCCTGACTAAGATGAGCGTCCCTGGAAGTCAAGCTGTTTTGTACTGCGACGTCAGTACGCAGATGCCCAGGCCGTTCGTCCCACGAGAGATGCGTCAGAAGGTATTTCAGTGCCTTCATTCACTCAGCCACCCCGGTCCCAACGCTTCAGCCAAACTCGTTGAACAACGATTCGTTTGGCCACTAATGCGGAAAAATTGCCGTGAATGGTCTAAGGCATGTTTGAATTGCCAGCGCTCGAAGGTCACAAGACACGTCACCGCCCCTGTGGGCAGGCATGACCTACCTTCAGCACGATTCAAACATGTCCACCTAGACTTGATCGGACCCCTACCGCCAGCAGGTGATTATCGGTACTGCCTTACAGCCGTCGATCGCTTTACGCGATGGGCAGAAGCTGTACCTCTAACCGACATCACCGCCAAAACAGTGGCCACAGCATTCATTTCATGTTGGGTGTCCCGATACGGTTGTCCTGTCGAGGTTGTCACCGACCGCGGCAGACAATTCGAGTCGGATTTATTTCTACGGTTGTCCAAGTCCATCGGCTTTGATCACCGTAGAACAACAGCATATCATCCACAGTGCAACGGTTTGGTTGAACGTTTTCACCGGCAGCTGAAAGCTGCGATAACTTGCCACGCAGACGCAAACTGGACTGAGACCTTGCCACTCGTCCTTCTCGGTATTAGGACTGCTTTCAAGGAAGACCTCCAAACGTCATCGGCAGAGCTGGTGTACGGTGAGCCTCTACGCTTACCCGGTGAATTCTTCGGTCACAATGTCACTCATCACACTACCGACGTCACCGACTTCTTGGCTCGTATGAGGTCCTTTGCAGAGAAGATACGCCCAGTCCCTCCTCAACACCATTCGACACAAAAAACATTCGTTTTTAAAGACCTCGCCACTTGTAGTCATGTATTCCTCCGAGAAGACTTGTTACGTGGCTCACTTCAACCTACATATACAGGGCCGCATGAAGTGCTTAAAAGAGGCGATAAATATTTTTCTATTCTTGTCAAAAACAAAGCTGTGACGGGTTCAAGACTTCAGCATCAGACTATGATGAATAAACACACCGGTTAG
Protein
MASPVAATDLTTFSSPPSHLRIPPFWPEKPAIWFAQIEGQFAVMRITDDATKFYHILSTLDRQYAAEVEDILTGPPDYNRLKDELIKRLSVSRENKVKQLLMHEQLGSRKPSQFLRHLQHLAGPGIPEDFVKTIWTSRLPTGLQPIIASQPSLSLDALAELADRVNDIATPVPQVASATTSTHIDELTRQVAELTKQVSALTAQINHHPSRGQRRPTKQQRSRSSSRRRSQSNYRQHPICWYHFRYGTKAVRCIQPCDYKALENSQQSGQSLMATQDCRNTTGRLFITDSKTKNQFLIDTGSDICVYPVSALRERRYKTSFQLSAANGSVIDTYGYIELNLNLGLRRDFPWRFVVADVTMAIIGVDFLSHYNLIVDISNQQLIDTLTNLKFVTSICKNNCLVTSVKIPTGGSGRYHNILAQYPEITRPAGTPGIVRHHTTHHIITTPGPPVSLPPRRLAPDKLRIAKQEFDAMLRNGTARPSCSPWASPLHLVSKKKDDGWRPCGDYRSAQEHEDHLHQLFTRMKEYGVLVNTTKCVFGVPEVTFLGYQISEKGTKPLVSKAEAIAKFPVPKTVRELRRFLGMINFYRRFLPNAAQIQAPLNALLVGSVKGAQPVVIEGKSLQAFQDCKTSLCNAALLAHPDTQAKLSLVTDASDSAIGGVLQQLKGGDWQPLAFFSRKLSPSQSKYSPYDRELLAIYESIKYFRHMLEATNFTVYTDHKPLCYAFQQPKHNCSPRQYRHLDFISQFTTDIRFVSGKDNLVADTLSRICELQMPVDLEEMAKLQTTDPELAEHLSGGTSLRLTKMSVPGSQAVLYCDVSTQMPRPFVPREMRQKVFQCLHSLSHPGPNASAKLVEQRFVWPLMRKNCREWSKACLNCQRSKVTRHVTAPVGRHDLPSARFKHVHLDLIGPLPPAGDYRYCLTAVDRFTRWAEAVPLTDITAKTVATAFISCWVSRYGCPVEVVTDRGRQFESDLFLRLSKSIGFDHRRTTAYHPQCNGLVERFHRQLKAAITCHADANWTETLPLVLLGIRTAFKEDLQTSSAELVYGEPLRLPGEFFGHNVTHHTTDVTDFLARMRSFAEKIRPVPPQHHSTQKTFVFKDLATCSHVFLREDLLRGSLQPTYTGPHEVLKRGDKYFSILVKNKAVTGSRLQHQTMMNKHTG

Summary

Pfam
PF00665   rve        + More
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00078   RVT_1
Interpro
IPR041577   RT_RNaseH_2        + More
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
Gene 3D
PDB
4OL8     E-value=1.40191e-38,     Score=405

Ontologies

Topology

Length:
1162
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06918
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00063
outside
1  -  1162
 
 

Population Genetic Test Statistics

Pi
11.464101
Theta
11.962585
Tajima's D
0
CLR
0.324677
CSRT
0.373631318434078
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号