SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09397
Annotation
PREDICTED:_calcium/calmodulin-dependent_protein_kinase_kinase_2_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.487
 

Sequence

CDS
ATGGTGTTAAATATTTGTGCTGTGTACATCCCATCTCCTTTGAATGTTGATTATGTCGACATTTTTACCAAAAATACTGTGCAGGTTATTCACAACAACATGACAAAAGGTATTACTGAACCATTATTTCTTTTAGTAGGAGACTTTAATATGGGGGATATTGAGTGGTGTAAAGATAATTCTTCTGCATATATGACCCCATCAACATCAGGGAATAATGTCTATACAGAATTTTTAGACGCCATGTCTTACTGCGACCTTTATCAGTTTAATGATATGATCAACGCTAATAATCGAATCCTTGACTTGGTATTTAGTGGTGCGTCAAGTGATATCTCAATTGAATCTGCCAAGGGCTTTTCGACTGCACCTGACCCATACCATCCGCCACTGGACATTGCATTTCAAGAAACATCTGTGCATGTTGTGAAACCTGACTCTGCCCCAGCATTAAACTACTTCAAATCCAATTATGAGGCTCTGAATAAAGACTTAAAGCAGGTTGATTGGACCAACTTACTACAAGAATCATATTCTGTGGATACAATGGTTGACCATTTTTATCAGACGATCAGACCGTTAATCAATCAGCATACTCCACTCCGCTTCCAACATAACGATCGTTACCCAATATGGTTTAGTAATTCCTTAATAAAAGCTCTTAAACATAAACGTAAATTTCACTCCAGATACAAAAAATACGGAAATTTAATGGATAAGCTGCAATTCGATATAACAAGAAAGCGATGCGATGTAATGATAACTGAATGTTATTCCAATTTTAAACAGAATGCTCCCAATCATCTCAAAAACCGTCCGAAATACTTCTGGAAAATTTTTAAGGATAAAACAGCTAATAGTCGTTCTTTGCCTAACGAAATGAAGCTTGGTCGGGTAGAGGCTAAGGGAGGACAGGAGATCTCTGAATTATTCTCTCAACATTTCCAAAGTGTGTATGATTCCAACATTAATCATGAAAAAAGTTGCTCTTCTCATTATTGTAATGTGTCCGGCAATGCATCATATAATATCGTTGAAGTTAATGAAACCGAAGTTTTAAATCAGCTAAAGCTTTTAAATGCGGACAAAGGACCTGGCCCTGATTTGATACCTCCTATATTCATAAAAAAATGTGCTCTAAGTTTATATAAACCTCTAGCCAAAATTTATACCAAATCTCTCCAAAGTGGTGCTTACCCCACTCAGTGGAAATTAGCGCACTTAACACCGATCCACAAGGATGGGAGGCTGGATGATATAGCCCAATATCGACCTGTCTCCATACTGTCTGGGTTTGGCAAGGTATTGGAAGCCATAGTTAATAAAAAGCTGATAACTCATTTCAAGCAATCTATAGACACAAATCAACACGGCTTTCTGCCATCCAAATCGACAAATACTAACTTAGTTAGTTATGTTTCTGATATAATTGATACTATGGACGGAGGTGGCGAGGTGCACTCTATCTACACCGATTTCAGAAAGGCGTTTGACCTAGTTAACCATAACTGCCTATTACACAAGCTTGCAGAACTGGGCATCCATGGATCGTTACTGAGATGGTGCGAGTCGTACATACGCAACCGCTCGCAATTGGTAAACATTCAAGGGTTTAAATCTAGAGTGCACATGGTCCCATCAGGGGTCCCTCAAGGGTCTCATCTAGGTCCTTTCTTTTTCCTAGTCTACATCAATAACATTAAGCATGTCATTCAATCTAAATTTAAATTATATGCTGATGACTTAAAAGTGTATCGTGCTGTTGAAGACCATTCGGATATAATGGCTCTTCAGTCAGATATCAATGCGATTTACAAATGGAGTACGCAGAATTACATGCACTTGAATTTGCAAAAGTTGCACTTCCAAAGGATAGCCCACCGCGACATCAAGCCGGCGAACCTGCTGCTGCGCGAGGGTGGCGTCCAGGTGGCGGATCTGGGCGCGTGCGGCGAGCTGGCGGGCGCCGGCCGCGTGTCGGGCGCCGTCGGCACGCCCGCCTTCCGCGCGCCGGAGACCTTCGCCGGACCAGACAACTACGACGGACAGGCAGCTGACATTTGGTCTCTCGGGGTGACGTTGTACGCGATGGTGACAGGCAGAGTTCCTTGGGTCGGAACTTCCGTCGTGGAGCTCCAGAGGAAAATCCTGAATGATCCGCTGACATACCCTGCGAGATACCAGCCTTCGAAATCGCTGAGGCATCTTCTTAGTCGCATGCTAGATAAAGACCCAGCAAAAAGAGCCACTATGCCGGAAATTAAGGACGACGAATGGATTACAGCGGGAGGCAGGGACCTCCTGCCCTCGGAGCAGGAGAACTGCAGGCTGGTAGAGGTGACGGAAGAGGATATGGCGAGAGTCGTCACCTCTATACCTAACCTCTCTACGCTCATACTCATCAAAACTATGCTTAAAAAGCATAGCTTTCAGAACCCTTTCTTACGAAGTCGCGAAGGCAGCACTTCAAGAAGAGAATCCGGTAGCGGGAAAGGAGAGGGAGAGAAAACCGCGGCCGCCAAGAGAAGTGGTCTCGCCAGGGCTGGTAGATCCCTGTCGGCGCCCGGAAATTATCTCACGGAGAGACAATCTTCATTTGACGTAGCCCTGGAGTCAGTCGCAGAACGAGATCAGAACCAAGAGAAGGAGAAGTCTCCAGTCAAGGGCGAAGAGGAGTCTCGGTGA
Protein
MVLNICAVYIPSPLNVDYVDIFTKNTVQVIHNNMTKGITEPLFLLVGDFNMGDIEWCKDNSSAYMTPSTSGNNVYTEFLDAMSYCDLYQFNDMINANNRILDLVFSGASSDISIESAKGFSTAPDPYHPPLDIAFQETSVHVVKPDSAPALNYFKSNYEALNKDLKQVDWTNLLQESYSVDTMVDHFYQTIRPLINQHTPLRFQHNDRYPIWFSNSLIKALKHKRKFHSRYKKYGNLMDKLQFDITRKRCDVMITECYSNFKQNAPNHLKNRPKYFWKIFKDKTANSRSLPNEMKLGRVEAKGGQEISELFSQHFQSVYDSNINHEKSCSSHYCNVSGNASYNIVEVNETEVLNQLKLLNADKGPGPDLIPPIFIKKCALSLYKPLAKIYTKSLQSGAYPTQWKLAHLTPIHKDGRLDDIAQYRPVSILSGFGKVLEAIVNKKLITHFKQSIDTNQHGFLPSKSTNTNLVSYVSDIIDTMDGGGEVHSIYTDFRKAFDLVNHNCLLHKLAELGIHGSLLRWCESYIRNRSQLVNIQGFKSRVHMVPSGVPQGSHLGPFFFLVYINNIKHVIQSKFKLYADDLKVYRAVEDHSDIMALQSDINAIYKWSTQNYMHLNLQKLHFQRIAHRDIKPANLLLREGGVQVADLGACGELAGAGRVSGAVGTPAFRAPETFAGPDNYDGQAADIWSLGVTLYAMVTGRVPWVGTSVVELQRKILNDPLTYPARYQPSKSLRHLLSRMLDKDPAKRATMPEIKDDEWITAGGRDLLPSEQENCRLVEVTEEDMARVVTSIPNLSTLILIKTMLKKHSFQNPFLRSREGSTSRRESGSGKGEGEKTAAAKRSGLARAGRSLSAPGNYLTERQSSFDVALESVAERDQNQEKEKSPVKGEEESR

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF05699   Dimer_Tnp_hAT
PF14291   DUF4371
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR012337   RNaseH-like_sf       
IPR011011   Znf_FYVE_PHD       
IPR008906   HATC_C_dom       
IPR025398   DUF4371       
IPR001965   Znf_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
SUPFAM
SSF56219   SSF56219        + More
SSF57903   SSF57903       
SSF53098   SSF53098       
Gene 3D
PDB
6CMJ     E-value=1.24374e-34,     Score=370

Ontologies

Topology

Length:
894
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05925
Exp number, first 60 AAs:
0.00631999999999999
Total prob of N-in:
0.00037
outside
1  -  894
 
 

Population Genetic Test Statistics

Pi
283.517472
Theta
182.721018
Tajima's D
1.520212
CLR
0.156053
CSRT
0.789410529473526
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号