SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09392  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA012763
Annotation
pro-phenol_oxidase_[Bombyx_mandarina]
Full name
Phenoloxidase subunit 1       + More
Phenoloxidase 2      
Alternative Name
PO 1
Tyrosinase 1
proPO-P1
Phenoloxidase subunit A3
Processed phenoloxidase A3
Location in the cell
Nuclear   Reliability : 1.454
 

Sequence

CDS
ATGTCTGACGCCAAGAACAACCTGTTACTGTTCTTCGACCGTCCCTCAGAGCCATGCTTCATGCAAAAGGGAGAAGAGAATGCAGTATTCGAGATTCCTGACAATTACTACCCGGAGAAGTACCAGCGTGTGTCAAATGCTATAGGCAACAGGTTCGGTAGCGACGCGGGCCGCATGATACCCATTAGGAACATTGCCCTACCCAATCTGGACCTGCCCATGGAGCTGCCCTATAACGAGCAGTTCTCCTTGTTCGTCCCTAAGCACAGAAAATTGGCAGGAAGGCTGATTGACATCTTTATGGGAATGCGTGATGTTGAAGATCTTCAGTCTGTCTGTTCGTACTGTCAGCTGCGGATTAATCCTTACATGTTCAATTACTGCCTCTCTGTCGCCATTTTGCACAGGCCTGACACCAAGGGCTTGAGCATCCCGACTTTCGCGGAGAGCTTCCCCGATAAGTTCATGGACCCGAAAGTTTTCCGTCAAGCCAGGGAGGTGTCCAGCGTTGTGCCTTCTGGAGCCAGGATGCCAATAGTGATTCCGTCGAACTACACCGCGTCTGACACGGAGCCGGAGCAGCGCGTGGCGTACTTCCGCGAGGACATCGGCATCAACCTGCACCACTGGCACTGGCACCTCGTGTACCCCTTCGACGCCGCAGACCGCGCCATCGTCAACAAGGACCGCCGCGGGGAGCTCTTCTACTACATGCACCAGCAGATCATCGCCAGGTACAACGTTGAGCGTATGTGCAACAACCTGAGCAGAGTGAGGAGGTACAATAACTTCAGGGCCGCGATCGAGGAGGGCTACTTCCCCAAGCTAGACTCAACAGTCGCCAGCAGAGCCTGGCCTCCCAGGTTTGCTGGCACTACCATCCGTGACCTGGACAGACCCGTTGATCAGATCAGGAGCGACGTCTCTGAGTTGGAGACCTGGAGGGACAGGTTCCTGCAAGCTATCGAGAATATGTCCGTGATGCTGCCCAACGGTCGTCAACTTCCCTTGGATGAGGAGACCGGCATCGACGTGCTGGGCAACCTTATGGAGTCCTCCATCATCAGCAGGAACCGACCCTACTACGGCGACCTCCACAACATGGGACACGTCTTCATCTCTTACTCTCATGATCCTGATCATCGTCATCTGGAGCAATTCGGCGTGATGGGTGACTCCGCGACGGCCATGCGGGACCCGGTGTTCTACCGCTGGCACGCGTACATCGACGACATCTTCCACCTCTACAAGTACAAGCTCACGCCCTACGGTAACGACAGGCTGGACTTCCCCAACATCAGGGTGTCGTCCGTCAGCATCGAGGGTGGCGGAACTCCCAACACGCTGAACACGCTGTGGGAGCAGAGCACCGTGGACCTTGGCCGTGGAATGGACTTCACTCCTCGCGGCAGTGTCCTCGCCAGGTTCACGCACTTGCAGCACGACGAATACAACTATGTGATCGAAGTGAACAACACAGGAGGCGGCAGCGTAATGGGAATGTTCAGGATATTCATCGCACCAACAGTGGACGAAAGTGGGAAGCCATTATCCTTTGACGAGCAAAGGAAACTAATGATTGAACTGGACAAATTCTCTCAAGGAGTGAAACCTGGCAACAACACAATCCGACGTAAGAGTATAGACTCCTCAGTGACTATACCGTACGAGAGGACGTTCCGCAACCAGGCGGACCGGCCAGCAGATCCAGGAACCGCTGGGGCTGCCGAGTTCGACTTCTGCGGCTGCGGGTGGCCTCACCACATGCTGGTGCCCAAGGGAACTACTCAAGGATATCCTATGGTGCTGTTCGTCATGGTGTCCAACTGGAATGATGACCGAGTGGAGCAAGACCTGGTGGGGTCGTGCAATGACGCGGCGTCGTACTGCGGCATCCGCGACCGCAAGTACCCGGACCGGCGCGCCATGGGCTTCCCGTTCGACCGGCCCGCGCCCGCCGCCACCACGCTGTCCGACTTCCTGCGCCCCAACATGGCCGTGCGCGACTGCATCGTGCGCTTCACCGACAGGACCCGCCAGCGCGGCCAGCAGGGATGA
Protein
MSDAKNNLLLFFDRPSEPCFMQKGEENAVFEIPDNYYPEKYQRVSNAIGNRFGSDAGRMIPIRNIALPNLDLPMELPYNEQFSLFVPKHRKLAGRLIDIFMGMRDVEDLQSVCSYCQLRINPYMFNYCLSVAILHRPDTKGLSIPTFAESFPDKFMDPKVFRQAREVSSVVPSGARMPIVIPSNYTASDTEPEQRVAYFREDIGINLHHWHWHLVYPFDAADRAIVNKDRRGELFYYMHQQIIARYNVERMCNNLSRVRRYNNFRAAIEEGYFPKLDSTVASRAWPPRFAGTTIRDLDRPVDQIRSDVSELETWRDRFLQAIENMSVMLPNGRQLPLDEETGIDVLGNLMESSIISRNRPYYGDLHNMGHVFISYSHDPDHRHLEQFGVMGDSATAMRDPVFYRWHAYIDDIFHLYKYKLTPYGNDRLDFPNIRVSSVSIEGGGTPNTLNTLWEQSTVDLGRGMDFTPRGSVLARFTHLQHDEYNYVIEVNNTGGGSVMGMFRIFIAPTVDESGKPLSFDEQRKLMIELDKFSQGVKPGNNTIRRKSIDSSVTIPYERTFRNQADRPADPGTAGAAEFDFCGCGWPHHMLVPKGTTQGYPMVLFVMVSNWNDDRVEQDLVGSCNDAASYCGIRDRKYPDRRAMGFPFDRPAPAATTLSDFLRPNMAVRDCIVRFTDRTRQRGQQG

Summary

Description
This is a copper-containing oxidase that functions in the formation of pigments such as melanins and other polyphenolic compounds. Catalyzes the rate-limiting conversions of tyrosine to DOPA, DOPA to DOPA-quinone and possibly 5,6 dihydroxyindole to indole-5'6 quinone. Binds to the surface of hemocytes and is involved in hemocyte melanization.
This is a copper-containing oxidase that functions in the formation of pigments such as melanins and other polyphenolic compounds. Catalyzes the rate-limiting conversions of tyrosine to DOPA, DOPA to DOPA-quinone and possibly 5,6 dihydroxyindole to indole-5'6 quinonee (By similarity).
Catalytic Activity
2 L-dopa + O2 = 2 H2O + 2 L-dopaquinone
L-tyrosine + O2 = H2O + L-dopaquinone
Cofactor
Cu(2+)
Subunit
Heterodimer.
Heterodimer. Forms a complex with an interleukin 1-like protein as a consequence of a host defense response.
Similarity
Belongs to the tyrosinase family.
Keywords
Complete proteome   Copper   Direct protein sequencing   Disulfide bond   Glycoprotein   Melanin biosynthesis   Metal-binding   Monooxygenase   Oxidoreductase   Reference proteome   Secreted   Zymogen   3D-structure  
Feature
chain  Phenoloxidase subunit 1
EC Number
1.14.18.1
EMBL
BABH01004244    BABH01004245    D49370    BAA08368.1    EU569724    ACC69184.1    + More
AF178462    AAG09304.1    DQ289581    ABB92834.1    AB778568    BAM76811.1    DQ841706    NWSH01000045    ABH10016.2    PCG80267.1    KP974690    ALE19971.1    KY744277    ATD13326.1    AF003253    AAC05796.1    AY665397    AAU29555.1    EU046570    EU046571    EU046572    ABW16859.1    ABW16861.1    AGBW02007654    OWR54842.1    BABH01004242    BABH01004243    KT006134    ANH58159.1    GU199189    ACZ97553.1    GU214206    ADA60206.1    JF342362    AEA92682.1    KJ803014    AII22868.1    HM776513    ADL14486.1    KQ459582    KPI98957.1    HM026570    ADG65539.1    KPI98962.1    AF336289    AAK64363.1    KX437622    AQM36767.1    KQ460635    KPJ13408.1    KX452359    AQM36768.1    U86875    AAC34251.1    JTDY01006889    KOB65615.1    KPI98958.1    KPI98959.1    KPJ13410.1    GBXI01017411    JAC96880.1    JX110850    AFP81886.1    GDHF01011142    JAI41172.1    GAMC01009964    GAMC01009963    JAB96591.1    AY494738    AAR84669.1    CVRI01000070    CRL07388.1    JRES01000975    KNC26576.1    GDHF01026318    JAI25996.1    GAKP01021407    JAC37545.1    KNC26577.1    AF161260    AAD45526.1    KNC26609.1    KNC26607.1    KNC26610.1    JXJN01019700    CCAG010007845    CH478340    MH810192    EAT33194.1    QBC65457.1    DS231964    EDS29448.1    CH954177    EDV59434.1    CH940648    EDW59888.1    CH916367    EDW01791.1    CM000157    EDW89439.1    JX987234    AGC54939.1    JX987235    AGC54940.1    CH964154    EDW79825.1    KQ971348    KYB26937.1    AY884064    AAX84205.1    CH480816    EDW47034.1    CM002911    KMY92407.1    EFA05662.1    AB020738    BAA75470.1    AAAB01008859    EAA07521.2    APCN01000572    APCN01000573    AE013599    AY060652    AB055857    L76038    AF031626    AAC27383.1    AAD01936.1    OUUW01000001    SPP74446.1    CP012524    ALC40784.1    CH933808    EDW08685.1    CM000071    EAL25684.2    CH479183    EDW36098.1    AXCN02000327    KA648512    AFP63141.1   
Pfam
PF03722   Hemocyanin_N        + More
PF03723   Hemocyanin_C
PF00372   Hemocyanin_M
PF01401   Peptidase_M2
Interpro
IPR036697   Hemocyanin_N_sf        + More
IPR005203   Hemocyanin_C       
IPR000896   Hemocyanin/hexamerin_mid_dom       
IPR002227   Tyrosinase_Cu-bd       
IPR014756   Ig_E-set       
IPR005204   Hemocyanin_N       
IPR037020   Hemocyanin_C_sf       
IPR008922   Unchr_di-copper_centre       
IPR013788   Hemocyanin/hexamerin       
IPR001548   Peptidase_M2       
SUPFAM
SSF81296   SSF81296        + More
SSF48056   SSF48056       
SSF48050   SSF48050       
PDB
3HHS     E-value=0,     Score=3024

Ontologies

Topology

Subcellular location
Secreted  
Length:
685
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00938
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00032
outside
1  -  685
 
 

Population Genetic Test Statistics

Pi
291.748653
Theta
187.828951
Tajima's D
1.581708
CLR
0.159991
CSRT
0.80305984700765
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
24402669 NPVQPERDR 96.88 4e-19
28467696 NPYTTFGINK 96.88 4e-19
29197581 NNIIIFFDRPSEPCFMQK 96.88 4e-19
24402669 FTHINYR 96.43 2e-14
29197581 YKITPYGNDR 96.43 2e-14
24402669 NRPTEFPEDVFK 96.00 2e-11
28467696 NRPTEFPEDVFK 96.00 2e-11
24402669 HIEQFGVMGDSATAMR 95.45 7e-09
28467696 HIEQFGVMGDSATAMR 95.45 7e-09
29197581 HIEQFGVMGDSATAMR 95.45 7e-09
20822545 MPIVIPSNYTASDTEPEQR 100.00 1e-07
24402669 IFIAPTVDESGKPISFDEQR 95.24 2e-07
28467696 IFIAPTVDESGKPISFDEQR 95.24 2e-07
29197581 IFIAPTVDESGKPISFDEQR 95.24 2e-07
20822545 GEENAVFEIPDNYYPEK 100.00 1e-06
20822545 GLSIPTFAESFPDKFMDPK 100.00 2e-06
31223520 FLQAIENMSVMLPNGR 100.00 2e-06
26822097 IDFPNIR 100.00 2e-06
25044914 MNYGVNINEYEK 100.00 2e-06
24402669 MPIVIPSNYTASDAEPEQR 100.00 2e-06
28467696 MPIVIPSNYTASDAEPEQR 100.00 2e-06
29197581 KSIDSSVTIPYER 100.00 2e-06
20822545 RGELFYYMHQQIIAR 100.00 1e-05
26822097 SIDSSVTIPYER 100.00 1e-05
25044914 GEEIISGAQR 100.00 1e-05
24402669 GDWIYPEIIIEPR 100.00 1e-05
28467696 GEEIISGAQR 100.00 1e-05
29197581 FSQGVKPGNNTIR 100.00 1e-05
20822545 WHAYIDDIFHLYK 100.00 4e-05
20822545 LTPYGNDRLDFPNIR 100.00 1e-04
31223520 SIDSSVTIPYER 100.00 1e-04
20822545 FLQAIENMSVMLPNGR 100.00 1e-04
20822545 SIDSSVTIPYER 100.00 3e-04
20822545 HLEQFGVMGDSATAMR 100.00 4e-04
20822545 GELFYYMHQQIIAR 100.00 5e-04
25044914 FSQGIKPGNNTVR 100.00 0.014
24402669 FSQGIKPGNNTVR 100.00 0.014
28467696 FSQGIKPGNNTVR 100.00 0.014
29197581 FIQAIENMSVMIPNGR 100.00 0.014
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号