SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09376
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.401
 

Sequence

CDS
ATGTATGGCTGGAGGGTTTCCAGTCCCGAGGGTGTCTCGGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGAGGTGCTCCCCGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGACTCGGGTGCAATCAACCCCACCAGACCATCGGTGGGGAAAAAGAGGGGGCGAAGAAAAACACCATTGCCAACTTCCAATGACGGCAGCGCGTCATCCTCCGGCACTGAGGTGCCGGAAAAGACGATGGCCATCGAGGAGGTGACTCCGGTGGTTTCGGGGTCTGCTGCTGCGTCGGAAGACGCGATGCCTGCTCCCCAGTGGGCACCAGTAAGGAGGAGGGGCGCGGTGTCACCGGCGACGTCGGTGGAGTCGATGTCGACGTCGGCTGCGTCCCTGGCTAGCGGGGACGAGACGTTCCGGGACCTCGACCTTGCGCTTGTTAATTTAGGTAAGCTGCTGTCGACTGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGTTACCGGAAAAGGCTCCGGGAGGCAGCCGCTATGGTTAAAACGAGGCTGATCCCCACCATGTCCAAGCTCCATGACTTGGTAGCGAGCCGAGAGGTGGAGAGCAAAGGTCACGTCTCTCAGTTTGACTCCAGAGAGAGTCGCATCCCGGGAGACACCCCGGCCTTGCGGGGAGGGACTCCCCTGTTGTCGAGGCCCGCGCTGGCACGCGCTGGGCCCCCCGCGGGGGCGATGGATACTACTGTGCACTTGCGGTCCGCGATGAGTGTGGTGGCACCCATGCCAGAGCCCACCTCCGAGGCCCCTGTTCCGCTGGCGCTTACTCCTGCGATCCCTCGCCCTCCACGAAGGGTTGAGCTAAGGCCTGCGCCACCTCCGCGGATATCGGCCGCCCCTGCATCTGCACGTAGAGGAAAGATAAACCCTACGCCAGCGCGGGCTGAGGACATCCGTTCGCCACTGGCGAGGATGGTGGATGAGTGGCCAGCGCTACCGCGGCCCAGGCCTGCAGAGCCGCCTCTTTCGCCCTCGCGTGCTGCGGGGTCACAGAGGCCATACAACATGGCTGCTGGGACGGAAGAAGTAGACCACTCCCTCCCAAGCAGAGAGGAAATGGTGGCCTGCATTTCGCGGGCGGTGGCGGTTGAGGTTGGCAAGCACTTTGCCAGCCTCGAGAAGATACTCCGCTCCTCCATTGGCTCCGGGGACTGTGTCCCGGTGCCAACAAACGCCGCCGTCCCGCGGGGCCAGGCCGCCCGGCCGACCTCCACCCCCATCCCATCCACAAGGTTGGCACGACGTGGAGGCCGCAATGAAAATAACAGGGGTACGGGTGCCCAGAATCCTGCCCTGAAATCCCAGCCCCGTCCCCTTCCTCCTCCCCCGTCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCAAGAAAGGTAGGCAAAAGACAGAGGCTCCGGCAGCTCCCAGAGGGGGTCGAGCGCTGACCGCTGCAGCCCGAAGCACAGAGCTGGTGGCCGTGGCTGCTCCTCGCGAGGGTCGAGCACCGGCCACCAACAAGAAGCAGAACGCCAAGAAGAAGACGCGCGCAACGCGGTCGGCTGCCGTCGTAGTGACGTTGCTGCCAGCCGCCGCCGAAAAGGGCCTCACCTATAATGAGGTGATGGCCCAGGCGCGCGCGGCCGTCAACTTAGCGGAAATTGGGGCAGAGGAAGGCCTCCGCTTCCGGCATACCGCCAATGGAGCGAAGCTGCTGGAGTGTCCCGGTACGGATAGTTCTGGTGTCGCAGACAGACTCGTGGCGACGCTCCGCGTGGCGCTGCCGGAGAATGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATCAGGATCACCGGCCTGGACGACTGTGCCACCAAGGAGGAGGTGGCAGCTGCGATAGCCGCCCAAGGTGGATGTGCCTTGGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCCGGAGCTAGGTCAGCGTGGGCGCGCTGCCCTGTGGAGGCAGCTACTTCCTTGGCCACTCCTCCGCCGGGAAGGTCAATGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGGCACGGCCTCGCTAAGTGCACCAGCTTAGTTGACCGCAGCGGTCTATGTTTCCGCTGCGGCCAACCGGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGTAGGGCAAACCACCGGGCGGGAGGCAAGGCTTGCTTCCCGTCCAGTGTTAATACTGAACGCAACCGGCGCCGAAAATCAAGGCGCCGGCAGAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAATGTTGCAATCCCCACTGCGGCGCCGGTGCCGGAGGGTGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGACGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGGTGGTTCGGGGACGATAGCGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGACGATCCCCCCCTTGGCGATGGTGACCAAGGGCCAAGGGTTCGTCGCGGTACAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAATAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTTGCGGGGGACCTCAACGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTGTTGGAGAGGTGGGCGAACGTGACCGGCCTCTATTTGTTGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGTCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCAGAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTTCACACCCAGTTGAGGTCGAGGACGAAGCGGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGACGTGTCGATGCCCCGGATTAGCCCTCGACCTCCCAATCGCCAAGTGTACTGGTGGTCGCCCGAAATCGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCCAGTGCGCGAGGCATCGCCGCCGTCGCCTGCCGCGGCGCAACGATCCGGTGGCGTTCGCGGTGGTAGAGGCCCAGCTGTACGGCGCATTTCGCGTCGCACAGAGGGCGTTGCAGCTGGCCATCAGAAGAGCCAAGGACCAACACATGGAGAGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGACCCTATCACATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCAATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCACTGTTCCCGCAGGAGCAGGGGGGATTTGTCGCTCCCGCTATGGGCGCGCCGCCGGAGTACGACGGCGTCGCCCCTGCTGAGGTGCCCCATATAACAGGGGCGGAGCTCCGTGTGGCAGTACGCAAAATGTGCGCAAAGGACACTGCACCTGGCCCGGACGGCATCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTATAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTTGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGTTGGATGAGGTGGGCAAACTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGATCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTGGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTGTGGGGGTGGGGTGGCCTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCTCTACCTTCGCCGGCTGGTCGGCTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGGTCGTACATCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTACTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATATGTTACGCAGACGACACGCTGGTCGTGGCCCGGGGAGGGAGCTTTGCTGAGTCTGCTCGTCTTGCCACCGCTGGGGTAGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATCGGGGTCGGGGTGCAGTTAAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACATCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGGTCAATGGCCCTATACGGAGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTAACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGATTCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGTTACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTTGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCAACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCTAGCCCTGGCCCTCTAA
Protein
MYGWRVSSPEGVSDEGGCATGSGIPVEPRCSPIAGSMRSALASDSGAINPTRPSVGKKRGRRKTPLPTSNDGSASSSGTEVPEKTMAIEEVTPVVSGSAAASEDAMPAPQWAPVRRRGAVSPATSVESMSTSAASLASGDETFRDLDLALVNLGKLLSTVAAKGAEPGSSYRKRLREAAAMVKTRLIPTMSKLHDLVASREVESKGHVSQFDSRESRIPGDTPALRGGTPLLSRPALARAGPPAGAMDTTVHLRSAMSVVAPMPEPTSEAPVPLALTPAIPRPPRRVELRPAPPPRISAAPASARRGKINPTPARAEDIRSPLARMVDEWPALPRPRPAEPPLSPSRAAGSQRPYNMAAGTEEVDHSLPSREEMVACISRAVAVEVGKHFASLEKILRSSIGSGDCVPVPTNAAVPRGQAARPTSTPIPSTRLARRGGRNENNRGTGAQNPALKSQPRPLPPPPSSMDEGWTEVVKRGKKGRQKTEAPAAPRGGRALTAAARSTELVAVAAPREGRAPATNKKQNAKKKTRATRSAAVVVTLLPAAAEKGLTYNEVMAQARAAVNLAEIGAEEGLRFRHTANGAKLLECPGTDSSGVADRLVATLRVALPENEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCALESVTVGELRSGYSGARSAWARCPVEAATSLATPPPGRSMGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLAKCTSLVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSSVNTERNRRRKSRRRQKRRLARGALANVAIPTAAPVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDWWFGDDSGLAAIVIRRDATIPPLAMVTKGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANVTGLYLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSRVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRSHPVEVEDEAGWFRDTMRRICDVSMPRISPRPPNRQVYWWSPEIAQLRVECVRARRQCARHRRRRLPRRNDPVAFAVVEAQLYGAFRVAQRALQLAIRRAKDQHMESLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEQGGFVAPAMGAPPEYDGVAPAEVPHITGAELRVAVRKMCAKDTAPGPDGIHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLIGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVCGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPLYLRRLVGSYLEDRSVTCTGHGGVVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRLLGVAGALSRLLPNIGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRANLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPILVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECYHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGNDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADLALALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=2.25962e-11,     Score=172

Ontologies

Topology

Length:
1872
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14598
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1872
 
 

Population Genetic Test Statistics

Pi
1.036057
Theta
1.143458
Tajima's D
-0.891693
CLR
2.972211
CSRT
0.163141842907855
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号