SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09353
Pre Gene Modal
BGIBMGA002185
Annotation
PREDICTED:_neuroligin-1-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.88
 

Sequence

CDS
ATGGACAAACTTGAACTTCAATCAACTTGTTTCGAGAATATCAAGACTTTGTGTACAAACTACCGCAAAGATTCTTCGTCTCGAAAAACTGAAGAGTACCTCAACATACGTTTGTCATCTTTGGAAGAACAGTGGAGAGACTTCGAGGCGAGAAATGCCTTATTACTACTGGAACTGGAAGACAAAACTATACATTATTTCTCTGAAGACGTTTACAACAAAACTAAAGAAATGTATCTAGCAACAAAAACAGACATAAACAACAGACTTAAATACTTGAAACAGCAAAAACATAGTGTGAATTTTGACTTAAGTGACATTTCTGTTGACTACACTCAAGACTGCGAGGACGGAAAATCTGAAAAAATACAACAACTTTTAAATAAACAAGAATGCAATTTTAATGCGATTTATCATGCATTGTCTAAAATTGACATCATTAGAACTAGTGAAAAGTGGGAGCTGGAAGATAATTTTAACATTTTAAAATCGAAGTGGGAGTCCATCGACAAACTGCACTGGGAAATTGACTTTCAGCTGAAGGGGTCTAACGATCACTATTACCGGATGTACTCAGATATCGAAGAAAAATATGATGAATTGAGAAAACAACTTCAATCTAAAATTTGGTCGAATGCACACTATCAGCAGTCGACACCGAGAATGGAATTACCTGATTTTTACGGTAACTACAGTAAGTGGATATCTTTTAAGGATCTGTTTCTTGAAACCATCCATAACAACCCAACAATTAACAAAGCGCAAAAAATGAAACACCTGAAAACCAAATTGAAGGGGGAAGCAGAAAGTCTGGTACAGCATTTATCCGTCTGTGCTGAAAACTACAACTCCTGCTGGGATATTTTAGTGCAACGGTATGATAATCGCCGCCTACAATTTTCATCGTTTTTCAACACAATGATGAGTCTCCCTGTTATACATCAACCCGACGCTAACAATCTCAAGAAAATGCATGACGTCATTAAGGAATGCATGAACGGCATAGCTAACATCGGACTGGATACGGCAACGTGGGATCCAATGATCGTGCATTTAATGTTACCAAAATTAGATTCAATAACTTTAAATGATTATATGAACGACATCCGAGATCACAGAGAATTACAAAACTTGCAAGATTTTTTATATTTTTTGGAGTGCAAGTTTATGGCATATGAAACTGCAAAATCAACAAAATCTGTAAAAAATACCACTTCCGAAAAAACATCTCATTGGAAACCGGCTATCAACAAACAACCTGTAAAAAAATTTACATATGACTCTAAGAAAACTTATAACTATCACGCTACTTATGGAAAATGCCCGAATTGTAATGGAAATCATGTTTTAATGCAGTGTGCTAAATTTATTAACATGGATACTGCACAGCGAAACCACACTGTTGCGAAATTGAAACTCTGCAAAAATTGTCTCTATAGCCACAATAACGAAGAATGTAAATCAGCGAAAACGTGTAAGGAGTGTAACATGAAACATCATACCATGTTGCACAACGTGAACTGGAAAATTCCAGCGAATGGTAAAAATAACTTTGGACAACAAGCCTCCTCTTCTCAGCAACAAGCTTCGAATCACTTATCATCGGATAAAACTGAAATTTTACTAACTACAACTCTACTGAAAATAAAGGCTTATGATGGCACTTATGTAAAACTTAGGGCCCTCTTGGATCAGGGCTCACAAGTAAACTTAATAACAGAAAATGCCGCTCAGATATTACGCCTGCCGAGGAAAAGGTTCGCTGCTACCATCTCAGGGGTTGGTTCAGTATCTGGTGATTGCAGGGGTCAACTAAACTTATCTTGTAAATCAATAAACTCTGAATACGACTTCGAAATACAAGCACTTATAATGAAAAAACTTACAAATAACTTACCGAATGCTACTTTCGAAAAATCGAACTGGCCTCATTTGGAAAACTTAAAGCTGGCTGATCCTGACTTCAACATCTCTCGCCCCATCGACTTACTACTGGGTGCCGATGTTTATTCAGATATTATACTCAATGGAGTTTTGAAAGGAAGCTGTCAATCCCCTGTGGCACAACAGACACATCTAGGATGGATCCTATGTGGGAAAATGAAAACGTTTAATTGCCACGTGACCTTGGTGAACTTTGATGAATTAACAAAGTACTGGGAGAGCGAAGAAATACAAAATTCTGAAGATATTTCCAAGGACGATCAGTGTGAACAATTTTATTCGGAAACAGTACAACGTGCTCCCGACGGAAAATATATTGTGAAGATGCCACTCCGCCCTGACCTTAAAGAAAAATTAGGTCTCCTCTTTCATAGAGCGATTTTGATGTCCGGATCTGGACTCAGCCCGTGGTCTTTGGTGGCCGACCCCAATAAGTACGCAGCAATTGTGGCAACACACGCCAACTGTTCACCAGACTTGACACCCCCAGCGCTGCTGCGATGCTTAAGAGAGCGACCATTAGAGGCATTACTCTCCGCACCAGTTCAAGCGCCTGACTTCGCTTATGCCTTCGGGCCGAGCGTCGACGGTGTTGTTATAGATACAGGAGATCTCTTAGTCAATCCAGAAAATGGTTACGAATGGGGCGGCCAGACAGTTGCCCATGCGCCAGTCGGGAAACAAGCACAGAACGCTATTAACATCATCAACGCTGTGCTGATGAGAAAAAGTGCGGTGGCGCAGCTGACCAAATACGATTTGATGCTCGGAGTCACTAAAGCGGAAGCTTACTTCGCATTCAGCGGTGACGATGTACAGTATGGGATAGAAGCGGACAGAAGATCGAAGATTCTCAAGTCTTTTGTCAGAAATACGTATAGCTACCATCTTTCTGAGATATTAGCGACGATTATAAATGAGTATACGGATTGGGAAAAACCTGTTCAGCATCCAATTAACATCAGAGATGAAACTTTAGAAGCACTTAGCGACGCCCAAGTCGTAGCTCCAATGGTGTTGACAGCCGACACACATTCAGCGCTAAGAAGAAATTCGTATCTATACGTTTTCGACTACCAGACGAAGTACGGTGACTATCCACAGCGTCAAGGCTGCATCCACGGGGAGGAGCTTCCGTACATATTCGGTGCGCCCCTGGTCGGTGGTTTGGCTCACTTCCCTAGAAACTACACGAAAGCTGAAGTCGGCCTGTCTGAATCCGTCATGTTATATTGGGGAAACTTCGCTAAGACTGGCAACCCTAATGAAGCTCAAGAGACTGATCCTATAAGAGCTGGAAGACAGGAGCGAGTTAGAATGAAGAACATCGAATGGACTGCCTACGAAGCTGTTCATAAGAAATATTTGAACATTGACATAAAGTCAAAACTCAAGAACCATTATAGAGCGCATAGACTTTCATTTTGGTTGAATTTAGTACCTGATCTGCATCGTCCAGGAGGCGAAGATGTACCGCCAGCTCATCATCAGCTTGAAAATGAGGACAACTCGATCCAGCCAACACCCAAGACTTATAGTCCAGCCTTCAAAAAAACAACTGACGTAATAGCTGATACAGGACTTGCCACAAAAATACCAGTTCTAAACGTTCTTAATATAACCTCATCGTTAAATTTCAATATCGTAGGAATGAATAGTGTTACTCAAAGTACTGCCAGTGAAGTACAAAAATCTGAAACCACAGCCGCTAGTCCGCCCGAAGATGGATTCGCTGCCTATTCCACAGCGCTCAGCGTGACAATAGCAATAGGATGCTCATTACTCATTCTCAATGTGCTTATATTCGCCGGAGTATATTATCAAAGAGATAAAACAAGGATGAACGGCCAAGACGGACACAATAATGGATCGCATCTAAAGAAACGCGTCGAAAATGGCCAGATGCCAAATAATATTTGCGGCGATCTCGAAGGAGCTTTATCGTATCAGACCAGTCTGAAAAACGATCCCGCGACAATATTGAGCCACCACCACACGCATTCACATCACCAACTGCCACCGCCAGAGTTTGCCGATTTACCAGGAAACAACGTGGCGGGCATGGCCACGCTACCAAGAGCCCCGCCGCCACCGAAAATAGGCAAAACTATAAACACACTAGCCAGTGGTCAGCTACAGGAGAACCAGCCTTTGTTATCGGCGCATCAGATGCAGATAATGAACACGAGCACTTTAACTAAGAAGAACACGCAGATGAATGCAAAGTCGAACGTCACGATGGAGGAGCTGCGGGTGTGA
Protein
MDKLELQSTCFENIKTLCTNYRKDSSSRKTEEYLNIRLSSLEEQWRDFEARNALLLLELEDKTIHYFSEDVYNKTKEMYLATKTDINNRLKYLKQQKHSVNFDLSDISVDYTQDCEDGKSEKIQQLLNKQECNFNAIYHALSKIDIIRTSEKWELEDNFNILKSKWESIDKLHWEIDFQLKGSNDHYYRMYSDIEEKYDELRKQLQSKIWSNAHYQQSTPRMELPDFYGNYSKWISFKDLFLETIHNNPTINKAQKMKHLKTKLKGEAESLVQHLSVCAENYNSCWDILVQRYDNRRLQFSSFFNTMMSLPVIHQPDANNLKKMHDVIKECMNGIANIGLDTATWDPMIVHLMLPKLDSITLNDYMNDIRDHRELQNLQDFLYFLECKFMAYETAKSTKSVKNTTSEKTSHWKPAINKQPVKKFTYDSKKTYNYHATYGKCPNCNGNHVLMQCAKFINMDTAQRNHTVAKLKLCKNCLYSHNNEECKSAKTCKECNMKHHTMLHNVNWKIPANGKNNFGQQASSSQQQASNHLSSDKTEILLTTTLLKIKAYDGTYVKLRALLDQGSQVNLITENAAQILRLPRKRFAATISGVGSVSGDCRGQLNLSCKSINSEYDFEIQALIMKKLTNNLPNATFEKSNWPHLENLKLADPDFNISRPIDLLLGADVYSDIILNGVLKGSCQSPVAQQTHLGWILCGKMKTFNCHVTLVNFDELTKYWESEEIQNSEDISKDDQCEQFYSETVQRAPDGKYIVKMPLRPDLKEKLGLLFHRAILMSGSGLSPWSLVADPNKYAAIVATHANCSPDLTPPALLRCLRERPLEALLSAPVQAPDFAYAFGPSVDGVVIDTGDLLVNPENGYEWGGQTVAHAPVGKQAQNAINIINAVLMRKSAVAQLTKYDLMLGVTKAEAYFAFSGDDVQYGIEADRRSKILKSFVRNTYSYHLSEILATIINEYTDWEKPVQHPINIRDETLEALSDAQVVAPMVLTADTHSALRRNSYLYVFDYQTKYGDYPQRQGCIHGEELPYIFGAPLVGGLAHFPRNYTKAEVGLSESVMLYWGNFAKTGNPNEAQETDPIRAGRQERVRMKNIEWTAYEAVHKKYLNIDIKSKLKNHYRAHRLSFWLNLVPDLHRPGGEDVPPAHHQLENEDNSIQPTPKTYSPAFKKTTDVIADTGLATKIPVLNVLNITSSLNFNIVGMNSVTQSTASEVQKSETTAASPPEDGFAAYSTALSVTIAIGCSLLILNVLIFAGVYYQRDKTRMNGQDGHNNGSHLKKRVENGQMPNNICGDLEGALSYQTSLKNDPATILSHHHTHSHHQLPPPEFADLPGNNVAGMATLPRAPPPPKIGKTINTLASGQLQENQPLLSAHQMQIMNTSTLTKKNTQMNAKSNVTMEELRV

Summary

Uniprot
ProteinModelPortal
PDB
3VKF     E-value=3.82202e-50,     Score=506

Ontologies

GO

Topology

Length:
1400
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.79069
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00014
outside
1  -  1232
TMhelix
1233  -  1255
inside
1256  -  1400
 
 

Population Genetic Test Statistics

Pi
271.829086
Theta
191.974509
Tajima's D
1.724631
CLR
0.534613
CSRT
0.83710814459277
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号