SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09350
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.022 Nuclear   Reliability : 1.558
 

Sequence

CDS
ATGTATGGCAGCGAAACATGGGCGGCAACCAAAAGGAACGTACATACCATTCAAGTTGCTGAAATGAAAATGCTGAGGTGGATGTGCGGCATGACTAGGCTCGATAAAATCCGCAACGAGTACGTGCGTGGAAGTCTAGGTGTACGGGACATCGCCGACAAGATGCAGGAGAGTAGGCTGAGATGGTATGGTCACGTAAAAAGGAAGCCACCTGACTACGTCGGAAATTTGGCGCTACTGCTCGACCTCCCCGGTCGGAGACCTAGAGGCAGACCCAAGACAAGGTGGAGGGACGTAGTGCTGAAGGACCAGAGAGAGAATGCAATGTTGCTGACGAGGATGTCGAAGACAGAGCGAAGTGGTGCAGTAAAGTCAGGAAAGCTGACCCCACCACCATGTGGGATAAATAGCTGGGAAGAGAGAGAGAGAGAGAGCGTACAGACGACTATTTCATGTACCTAA
Protein
MYGSETWAATKRNVHTIQVAEMKMLRWMCGMTRLDKIRNEYVRGSLGVRDIADKMQESRLRWYGHVKRKPPDYVGNLALLLDLPGRRPRGRPKTRWRDVVLKDQRENAMLLTRMSKTERSGAVKSGKLTPPPCGINSWEERERESVQTTISCT

Summary

Uniprot
Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
153
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00188
Exp number, first 60 AAs:
0.00162
Total prob of N-in:
0.22165
outside
1  -  153
 
 

Population Genetic Test Statistics

Pi
217.788257
Theta
138.600448
Tajima's D
1.868835
CLR
8.234085
CSRT
0.865706714664267
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号