SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09345
Annotation
PREDICTED:_uncharacterized_protein_LOC106114667?_partial_[Papilio_xuthus]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 3.591
 

Sequence

CDS
ATGGCGTCGCCTGTCGGGCCAGCGTGCCCGAATACAGAACTACCCTCAACACACATCAGGATACCACCGTTCTGGCCTGAAAAACCCGAAATATGGTTTGCGCAAGTGGAAGGACAATTTGCCATCATGCGAGTGACTGACGAGACGGCAAAATTTTATCATATATTGGCCAGCCTCGATCGCCAATATGCCGCCGAGGTAGAAGACGTGCTCACCGGTCCTCCCGATTACCAGCGGCTTAAAGAGGAGCTGATAAAAAGGTTGTCGGCGTCCCGCAGTAACAAGGTGAAGCAGCTATTGACGCACGAGCAGCTCGGTACCCGCAAACCGTCACAATTCTTGCGTCACCTACAACACCTCGCCGGACCGGAGATCCCGGAGGACTTCCTGCGGACTATATGGACCAGCCGGCTACCAACCACGTTGCAGCCGATCGTCGCGTCGCAGTCGACGCTTCCATTGGACGCACTCGCCGAGCTCGCCGACCGTGTCCACGAGATCGCAGCCCCAGTACACCACGTTGCGGCAGCCGTGACGTCATCATCATCATCGTCATCACAAATCGACAGGCTGTCCCAACAAGTAGCGGAGCTGACGCGGCAAGTCAGCGCCCTGACGACGCAGGTGCATCATCAACCGCGGCCGCAGGAGCGCGGGCGCGAACGTGGACGTCAACGACAACGCAGCCACTCATCCTCACGCCGGTCGCAGTCACACTACCGCAGGTACCCCATTTGCTGGTACCACAGCAAACACGGTGCCGAGGCGCGGAAGTGCGTGCGACCCTGCGACTACAAGGCGGGAAACCCGACAAGCAGGCAAGTGATGGCGACTCGCGACTGCCACAACTCTACGGGTCGCCTCTTCATCAAGGACCGCAGCAATAATATAGACTTCCTCATAGACACTGGAAGTGACATTTGTGTTTACCCTATTCATAAGTTGTGTGAACGCCGTGCTAAAACTAGTTATCAGCTCAGTGCTGCCAATGGTACAGTTATAGACACTTATGGTTATACGCAATTAAATGTTAATTTAGGCTTACGCCGCAACTTTCCATGGCGCTTTGTTGTTGCTGACGTCACAAAAGCCATTATAGGCGTCGATTTTTTGTCTCATTATCGACTCATAGTGGACGTCAGCCAACAAAGATTAATCGATAGTCTTACCAATATGAGCACTGTAGCCAGTCTAGATGTAAATAATAATCGTGTTACTAGTGTTAAGATAATGACAGGTGGCGACAGTAAGTACCACGCTATCTTGGCTGAATACCCGGAGCTAACACGCCCAGCTGGTACTCCAGGTATTGTCAAACACAACACGAAACACTACATACGCACTACACCAGGTCCACCCGTAGCATGCTCACCCCGTCGTCTCGCGCCGGACAAACTTAAAATTGCAAAACAAGAATTTAATATTATGATAGCCAACGGAACTGCACGTCCGTCTGACAGTCCATGGTCATCCCCGCTTCATCTTACTACCAAGAAGGACAACGGTTGGCGACCATGTGGTGATTACAGACAGTTAAATTCACGCACAATACCCGATCAGTATCCGATTCGTCATATACACGATTTTTCACAAAGTTTGTCTGGTTGTAAAATTTTTTCTGTCATCGATTTGGTCAAGGCCTATAATCAGATACCAACAGCGGAGGAGGATATCCCAAAGACCGCGATCACCACGCCATTTGCAAAACGCCACGTGACCACGAGGACCACTTGCGCCAACTTTTCAATCGTATGA
Protein
MASPVGPACPNTELPSTHIRIPPFWPEKPEIWFAQVEGQFAIMRVTDETAKFYHILASLDRQYAAEVEDVLTGPPDYQRLKEELIKRLSASRSNKVKQLLTHEQLGTRKPSQFLRHLQHLAGPEIPEDFLRTIWTSRLPTTLQPIVASQSTLPLDALAELADRVHEIAAPVHHVAAAVTSSSSSSSQIDRLSQQVAELTRQVSALTTQVHHQPRPQERGRERGRQRQRSHSSSRRSQSHYRRYPICWYHSKHGAEARKCVRPCDYKAGNPTSRQVMATRDCHNSTGRLFIKDRSNNIDFLIDTGSDICVYPIHKLCERRAKTSYQLSAANGTVIDTYGYTQLNVNLGLRRNFPWRFVVADVTKAIIGVDFLSHYRLIVDVSQQRLIDSLTNMSTVASLDVNNNRVTSVKIMTGGDSKYHAILAEYPELTRPAGTPGIVKHNTKHYIRTTPGPPVACSPRRLAPDKLKIAKQEFNIMIANGTARPSDSPWSSPLHLTTKKDNGWRPCGDYRQLNSRTIPDQYPIRHIHDFSQSLSGCKIFSVIDLVKAYNQIPTAEEDIPKTAITTPFAKRHVTTRTTCANFSIV

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF00078   RVT_1
PF17917   RT_RNaseH
PF17919   RT_RNaseH_2
PF10551   MULE
PF01087   GalP_UDP_transf
PF12017   Tnp_P_element
PF17906   HTH_48
PF00077   RVP
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR001995   Peptidase_A2_cat       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR001969   Aspartic_peptidase_AS       
IPR041373   RT_RNaseH       
IPR034132   RP_Saci-like       
IPR041577   RT_RNaseH_2       
IPR018289   MULE_transposase_dom       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR021896   Transposase_37       
IPR041426   Mos1_HTH       
IPR018061   Retropepsins       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF54197   SSF54197       
SSF56219   SSF56219       
PDB
4OL8     E-value=5.36059e-14,     Score=190

Ontologies

Topology

Length:
584
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01484
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00019
outside
1  -  584
 
 

Population Genetic Test Statistics

Pi
187.722025
Theta
26.64883
Tajima's D
4.206125
CLR
0
CSRT
0.999350032498375
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号