SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09344
Pre Gene Modal
BGIBMGA002180
Annotation
PREDICTED:_neuroligin-4?_Y-linked-like_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.684
 

Sequence

CDS
ATGCAAAACGATCAACCAAGCGATGAAAACTATGACGATCATGATCGAGAACACGACCCCGTAGATTATGCCAAAGTCAATTTCGATCACAATCCATTTTTCAATAGTGAAGATTTCCTACAAAAATTCTACAATAGCGATAACAGTGCATATAGTAATTACGATGACTATAAAAAGTACTACTTAAACCCGTCGAATCCTATTCCTAAATCTAAAGTGAAATTTAAAATAAGCAGTAGGATAGTACAAACTAAATATGGGAAATTACAGGGCATAGTATTGGCTATGGACGAACATAGATATTTGAGTCCTCTTGAAGTGTTCTTAGGTGTACCGTACGCTACTCCACCCGTTGGATCTAACAGATTCAGTCCAACAAGAACTCCATCACCTTGGGACGGCGTCAGGGTATCAGATAGGCCAGGTCCAGCCTGTCCCCAGACGCTACCAGATATTGAAGATGAAAGGACGATTTTAGAGAAGATGCCTAAAGGCAGATTAGAATATTTGAAAAGACTGATGCCTTATCTTAAGAATCAAAGCGAGGATTGCTTATATTTAAACATTTTTGCTCCTCTACAAATGGACGAAACTAAACTAGAATTGCCTGTACTAGTGTATATTCACGGAGAAAGTTATTCTTGGAGCTCGAGTCATCCTTACGACGGAGCTGTCCTGGCCAGCTACACTGACCTCATCGTGGTGACACTTAATTTCCGATTAGGGGTCTTAGGCTTCCTCAACGCTAATCCTGTACCTCACCTCAAAGCTCGAGTGGCGAACTACGGCCTTATGGATCAAATCGCAGCTCTACACTGGGTCCAACAGAATATTGCACTGTTTGGAGGAGATCCAAACAATATTACGCTCATGGGTCACGGATCGGGAGCGGCTTGTATCAATTTCCTCATGATATCACCTACTGTGATGCCAGGTCTTTTTCACAGAGCGATACTCTTATCAGGCTCCGCGCTCAGCTCGTGGGCTATAGTCGACGACCCTGTCTATTATTCTCTTAAGCTAGCCAAGCATATGAACTGCACCGTTCCAGAAGACTTATCGAAAGATCATGAAGTAATCGTGGATTGTTTACGAGAGGCTAGCATAAGAGACTTGTTGGCAGCAGATATATCACCACCGAATTATTTAACAGCCTTTGGGCCTTCAGTGGACGGAGTGGTCATAAAAACGGATTTCGGCAAAGACTTCTTGACCATGTACTCGACAGGAGATTTTCCGAGTTTCGGTCCTCTCAATAATATGAATTTCAACTTTAACGTTCACAAAAAAAGGAGTGACAGCGGTCGAAGGTTGTTCCAGAACAAATACGATTTGCTATTTGGAGTTGTGACCAGTGAGGCGCTGTGGAAATTCTCGGCTGGTGATGTTCAAAACGGGATAGAACCTGATAAAAGAGATCGTATGTTGAGAACATACGTCAGGAATTCGTATACATACCATTTAAGCGAGATTTTCTACACCATCGTAAATGAATACACCGATTGGGAACGAACGGTAGAGAGTCCAACAAACACAAGAGATGCAACTGTAGCGGCACTCTCTGATGCTCAATATGTAGCCCCGATAGTGCAAAGTGGTGATCTGCTCAGCGGTGGACCCAAGCCAGCGCCTAATGATGACGAAGGACCAGGACGGCCGACCAAGACTTACTTCTATGTTTTCGATTACCAAACCAAAGACGGATATTATCCTCAGAGGCTAGGCGCAGTTCACGGGGAAGAGCTTCCGTATGTGTTCGGGGCGCCCGCTGTTGATGGGTTTGGTCATTTCCCGCAAAACTATACGAAGTCTGAACTGGCTTTGTCAGAGTCTATAATGATGTTCCTCGCCAACTTTGCGAAGACCGGCGATCCTAACGACAACACGCGGCAGGAAGCGTTATTGCCGGCATCGAGAGAGCGAAATAAGTTCCGGGGGGTTAATTGGGAGGAATACGATTCAACTCACCAGAAATATTTGGAAATAGGTATGAAACCTCGCCTGAAAAACCACTACAGGGCACACCAGCTCTCTGTGTGGCTTCGACTGGTTCCTGAATTACACCGCGCCGGCATGGAAGACGTCGCAGCAAGGCACAACTTGTTCAAAAACCACAACGAGCAGGATCTGTATGAAGGGATCGTCAGACCCGATCCTTTAGCGAGGAATAATGACAATGAACCGATCAGAAGAGGGAACGGATCTTATGCTGAAACAGCTCTGAGCACGGTGGATAGTATTTTAGCCACTTGTGCCACGATATTACCAGGAAGAGACCTGCAGACTACGAACACAACGGATAATACACTAGGACATTTAGAGGCAGCGGGATATGCAGCGTACTCAACCGCTCTGAGCGTTACTATAGCCATTGGGTGTTCTTTACTAATATTAAACGTTCTGATATTTGCTGGTGTTTATTACCAAAGAGACAAGTCAAGGTCTCGCGGTAAGCAGCACCGTTTTAACGAGAAACACTTCGAGACAATATCAGGAAAGCATTCTCATTATCACATCGATCCGACGCACGCGCCCAGTCTGGTCGTTGACGTCGAGAGACAAAGCCGAAAGAAGCACATGATGGGTACGGAACAGCACCTGTCAAATTTGAACTTCAAGGGGCCTCTCGATGTACCGAAATCGCCTCCGAGCCCGTCTCTGAGTTTGGACAACATGATGCTATCAAGTAAACTGGGGAGCAGGGCAAACAGTTTTCGGATACCAAACTCCGGCTATCCCCAGGTAGGCAGCTACGCGACTATGCCTAAGAATTCGGGGCAGTTTAATAACTCGCCCCCTTTGCAAGAGTTGAGGCAGAAATACCAGCCGCCTAACGGCTCGACGGGGCAGGGTTCCCCTCGCAGGGAGGAGAGGGCGGCCCACGCCACATTACGGCGGGGCGCACCATCTAACCTACCGCAGGCTGCGATTGACGAAATGAGAGTGTGA
Protein
MQNDQPSDENYDDHDREHDPVDYAKVNFDHNPFFNSEDFLQKFYNSDNSAYSNYDDYKKYYLNPSNPIPKSKVKFKISSRIVQTKYGKLQGIVLAMDEHRYLSPLEVFLGVPYATPPVGSNRFSPTRTPSPWDGVRVSDRPGPACPQTLPDIEDERTILEKMPKGRLEYLKRLMPYLKNQSEDCLYLNIFAPLQMDETKLELPVLVYIHGESYSWSSSHPYDGAVLASYTDLIVVTLNFRLGVLGFLNANPVPHLKARVANYGLMDQIAALHWVQQNIALFGGDPNNITLMGHGSGAACINFLMISPTVMPGLFHRAILLSGSALSSWAIVDDPVYYSLKLAKHMNCTVPEDLSKDHEVIVDCLREASIRDLLAADISPPNYLTAFGPSVDGVVIKTDFGKDFLTMYSTGDFPSFGPLNNMNFNFNVHKKRSDSGRRLFQNKYDLLFGVVTSEALWKFSAGDVQNGIEPDKRDRMLRTYVRNSYTYHLSEIFYTIVNEYTDWERTVESPTNTRDATVAALSDAQYVAPIVQSGDLLSGGPKPAPNDDEGPGRPTKTYFYVFDYQTKDGYYPQRLGAVHGEELPYVFGAPAVDGFGHFPQNYTKSELALSESIMMFLANFAKTGDPNDNTRQEALLPASRERNKFRGVNWEEYDSTHQKYLEIGMKPRLKNHYRAHQLSVWLRLVPELHRAGMEDVAARHNLFKNHNEQDLYEGIVRPDPLARNNDNEPIRRGNGSYAETALSTVDSILATCATILPGRDLQTTNTTDNTLGHLEAAGYAAYSTALSVTIAIGCSLLILNVLIFAGVYYQRDKSRSRGKQHRFNEKHFETISGKHSHYHIDPTHAPSLVVDVERQSRKKHMMGTEQHLSNLNFKGPLDVPKSPPSPSLSLDNMMLSSKLGSRANSFRIPNSGYPQVGSYATMPKNSGQFNNSPPLQELRQKYQPPNGSTGQGSPRREERAAHATLRRGAPSNLPQAAIDEMRV

Summary

EMBL
BABH01029721    BABH01029722    BABH01029723    BABH01029724    KP308206    ALH43424.1    + More
ODYU01001227    SOQ37150.1    NWSH01000115    PCG79397.1    KZ150096    PZC73599.1    RSAL01000099    RVE47584.1    KQ461187    KPJ07360.1    KQ459581    KPI99135.1    AGBW02008258    OWR53904.1    KY021889    AQY62778.1    KQ971342    KYB27544.1    AGBW02014763    OWR41088.1    KQ460154    KPJ17231.1    KZ150139    PZC72958.1    GEYN01000074    JAV02055.1    KPI99129.1    ODYU01003066    SOQ41368.1    KQ981676    KYN38135.1    AAAB01008879    EAA44773.5    FJ580050    ACM48188.1    DS235124    EEB12234.1    CH940650    EDW66773.2    JRES01001389    KNC23200.1    CM000070    EDY68564.3    CH933806    KRG01620.1    OUUW01000008    SPP83978.1    EDW15559.2    KRG01621.1    KRG01622.1    KJ702186    AID61340.1    APCN01002110    UFQT01002602    SSX33753.1    GGMR01018148    MBY30767.1    CVRI01000047    CRK98256.1    GGMS01006704    MBY75907.1    ADMH02000570    ETN65853.1    BABH01029677    AXCN02000220    CP012526    ALC46886.1    GEBQ01006118    JAT33859.1    KK107238    EZA54825.1    ADTU01020531    ADTU01020532    ADTU01020533    ADTU01020534    ADTU01020535    ADTU01020536    ADTU01020537    ADTU01020538    DS232169    EDS36558.1    QOIP01000007    RLU20424.1    KQ977231    KYN04733.1    KQ982727    KYQ51589.1    KQ435007    KZC13423.1    AXCM01014898    KZ150175    PZC72572.1    NWSH01000461    PCG76243.1    KPI99138.1    FJ580049    ACM48187.1    AAZX01004420    AAZX01004645    AAZX01007714    AAZX01009171    AAZX01010230    AAZX01010833    AAZX01012199    AAZX01012817    AAZX01014915    AAZX01022750    AXCN02000135    GFDL01003836    JAV31209.1    GL732645    EFX68935.1    AAAB01008888    EAL40590.4    APCN01005506   
Pfam
PF00135   COesterase
Interpro
IPR019819   Carboxylesterase_B_CS        + More
IPR029058   AB_hydrolase       
IPR002018   CarbesteraseB       
IPR000460   Nlgn       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
3BE8     E-value=2.19877e-107,     Score=998

Ontologies

Topology

Length:
982
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.69081
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01482
outside
1  -  785
TMhelix
786  -  808
inside
809  -  982
 
 

Population Genetic Test Statistics

Pi
235.297867
Theta
171.74731
Tajima's D
1.038249
CLR
0.244269
CSRT
0.667966601669917
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号