SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09338
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.218 PlasmaMembrane   Reliability : 1.206
 

Sequence

CDS
ATGGGGCACGTCCATCGCTTCCTCCAGGCCAATCTGAACCACTCCGCCAGGGCGCAGGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATTGATGTCGCTGTCGCCGCGGAGCCGTACTTCGTCCCTGCTGATCAGGATTCCTGGATCGGGGACATCGACGGCTCCGTGGCAATCATAATCAGACAGGCTGCGGCGTTACCCCCCCTGGTGATGGTGGCCAGGGGATCCGGTTACGTCGCGGCCAGGGTCGATGAAACCGTCGTGATCGGGGTGTACTTCTCTCCGAACAGACATCTCGCTGAGTTCGAGCGGTTCTTGGGCGGGCTCGAGGCGTTGGTTAATCGCCTCGGGTCTCGCCCGGTGATTTTAGCGGGAGACCTCAATGCCAAATGGGTAGCTTGGGGTTCCCCCCGCCCGAACTCGCGCGGCAGGATGCTCTCGGAGTGGGCGATCGCGGCCGGTCTCTGTCTCTTGAACAGGGGTTCGGTCGCGACTTGCGTGCGATGGATCGGCGAATCTCACGTGGATGTGACTTTCGCATCTCCTTCCATCGCACGCCGCACCCGTGGCTGGCGTGTCCTTGAGGGGGCGGAGACGCTCTCGGATCATCGATACGTCCGATTTGAGCTCTCTGCCTCTTCTCGCTCTGCGTCAGCTATGGTCGCCCGTGGTGAGGAGGAGCTCCCGCGTAGTACGCCTCGATCATTCCCCAGGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGGTGGAGGCGGCTGCAGTGGCTGCGTGGGCACCCGTGCCCGCGAGCCCTGTGGATGTGGAGTCGGAGGCTGACTGGTTCCGGGGAACGATGTGTCGGACTTGCGATGCAGCGATGCCCCGGGTAGGTGGCCACGCTCCGCGTGGTCACCCAATATCGCGCAACTCCGTGAGGAGTGCGTGCGGGCGCGCCGCCGGAGCGCTCGCCACCGCCGCCGCCGTCTTCGCGATGACGACTTTGCGGAGGCGGCGGACCGGCTGCACGCCGACTGCCGTCAAAAGCAAGAGGCGTTGCGGCTGGCCATCGGGAGAGGGGACTTTTCGGCCCCCTTTCATGGGCACGCTACCACGTCACGATGGTGGTGATGCCCCTGCCGACGTGCCCCCTCCGAAGATTTCGGGGGCAGAGATCCGTGCGGCCGTGTCAAAGATGAGGAGGAAGGACGCGGCCCCCGGCCCTGATGGTATTCACGGCCGGGTCTGGGTTTTGGTCTTCGGTGCTCTGGGGGACCGGCTTGTGCGACTTTTCGAAGCTTGCCTTGAGTCGGGACGGTTTTCGACCCAGTGGAAGACGGGCAGACTCGTCCTTTTGAGGAAGGAGGGGCGCCCGGCGGACTCACCCGCGGGGTACCGCCCCATTGTGTTGCTGGACGAGGCGGGAAAATTGTTGGAGCGAGTTGTCGCCGCCCGCATCGTCCGGCACCTGACTGGGACGGGTCCCGATCTATCGGCGGAGCAGTACGGCTTCAGAGAGGGCCGCTCTACCATCGACGCGATTATGCGCGTGCGTGCCCTCTCTGATGAAGCTGTCGCCCGGGGTGGGGTGGCTCTGGCAGTGTCCCTGGACATTGCCAATGCTTTCAACACCTTACCCTGGTCAGTGATCGCGGGGGCGCTTGAATATCACTGCGTCCCTGCGTACCTCCGCCGGCTGATCGGATCCTATCTTGAGGACAGGTCGGTCGTATGCACCGGACACGGGGGTGCGGTGCTCCGCTTTCCGGTCGAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTTCTGTGGAATATCGGCTACGACTGGGTCCTGCGGGGTGCCCTTCACAGCCCTCTCCCGGGCCTACGCGTTGTGTGTTACGCGGATGACACGTTAGTCATGGCTCGGGGGAAAGACTACCATGAGTCAGCCCGTCTTGCCTGCGCAGGGGTGGCATTCGTCGTCGGTAATATTCGGAGGTTGGGCCTCGAGGTGGCGCTCGAAAAATCCCAGGCCCTGCTGTTTCACAGGGCTGGAAGAGAGCCGCCGCCCGGGGCCCACCTGGTGATTGGAGGCGTCCGCGTCGAGGTTGGGGCCCTCGGCTGA
Protein
MGHVHRFLQANLNHSARAQDLLVHTMAEWSIDVAVAAEPYFVPADQDSWIGDIDGSVAIIIRQAAALPPLVMVARGSGYVAARVDETVVIGVYFSPNRHLAEFERFLGGLEALVNRLGSRPVILAGDLNAKWVAWGSPRPNSRGRMLSEWAIAAGLCLLNRGSVATCVRWIGESHVDVTFASPSIARRTRGWRVLEGAETLSDHRYVRFELSASSRSASAMVARGEEELPRSTPRSFPRWALKRLNKELLVEAAAVAAWAPVPASPVDVESEADWFRGTMCRTCDAAMPRVGGHAPRGHPISRNSVRSACGRAAGALATAAAVFAMTTLRRRRTGCTPTAVKSKRRCGWPSGEGTFRPPFMGTLPRHDGGDAPADVPPPKISGAEIRAAVSKMRRKDAAPGPDGIHGRVWVLVFGALGDRLVRLFEACLESGRFSTQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVRHLTGTGPDLSAEQYGFREGRSTIDAIMRVRALSDEAVARGGVALAVSLDIANAFNTLPWSVIAGALEYHCVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVERGVPQGSVLGPLLWNIGYDWVLRGALHSPLPGLRVVCYADDTLVMARGKDYHESARLACAGVAFVVGNIRRLGLEVALEKSQALLFHRAGREPPPGAHLVIGGVRVEVGALG

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
1WDU     E-value=4.64699e-10,     Score=157

Ontologies

Topology

Length:
697
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.15016
Exp number, first 60 AAs:
0.00828
Total prob of N-in:
0.00477
outside
1  -  697
 
 

Population Genetic Test Statistics

Pi
3.359897
Theta
4.235893
Tajima's D
0.208803
CLR
0
CSRT
0.453027348632568
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号