SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09336
Pre Gene Modal
BGIBMGA002173
Annotation
PREDICTED:_neuroligin-4?_X-linked-like_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 2.165
 

Sequence

CDS
ATGGACCAAATAGCAGCCTTGCACTGGGTTCAACAGAACATCGCGCTTTTTGGAGGGGATGCTGGCAATGTAACCATGCTTGGACATGGCTCAGGAGCGGCTTGTATCAATTTCTTGATGATATCTCCAACTGTCATGCAAGGTTTGTTTCATCGAGCGATCCTTCTGTCGGGGTCAGCGTTGAGCTCATGGGCGTTAGTAGAAGACCCAGTCAGCTATGCCGTCCAATTAGCGAAGCAATCCAACTGCACTCTACCTGAAGACATAGTCAAAGATCATGAGCTAATAGTGGACTGTCTAAGAGAAGTTCCACTAGAAGAGTTGATGTCAGAAGCAATCAATACACCGAGCTATTTAACTGCCTTTGGGCCATCAGTTGACGGTGTGGTCGTCAAAACAGATTACGCTAAAGAACTCTTAACTTATTTCATACCAAACGACCTTCAAGGGTTCACCAGCGTGTCAGGAGTGAATAATTTCAAAGCTGACAAACGGAGTGGCGATAGGATATTTGGAATCAGAGGTGGCCAAAATAAATACGATCTTCTATTCGGCGTTGTGACCAGTGAGGCACTGTGGAAATTCTCCGCTCAGGACATTCAAAACGGCTTCGAGGGTGAAAGGCGGGACAGAATAATAAGGACTTACGTAAGAAACGCTTATACATATCATTTGAGTGAAATATTTTTCACGATTGTAAACGAATATACTGATTGGGAGAGAACAGTACAGCACCCAATCAATACAAGAGATGCAGCTGTTTTGGCGATATCAGACGCCCAGTATGTGGCTCCGCTGGTCCAAACTGGTGATTTCCTTAGTGTAGCCAAGAGCTCCCCTGACTCTGGACCGAACACATTCTTTTACGTCTTCGACTATCAAACTAAAGACGGAGATTATCCACAGAGAATGGGATCAGTCCATGGAGAAGAACTGCCGTATCTCTTCGGAGCTCCACTGGTTGAAGGCCTTGGACACTTTCCAAAGAACTATACGAAGTCCGAAGTTGCACTATCGGAGTCCTTTATACAATATATTGCTAACTTCGGACGGAGTGGGTAA
Protein
MDQIAALHWVQQNIALFGGDAGNVTMLGHGSGAACINFLMISPTVMQGLFHRAILLSGSALSSWALVEDPVSYAVQLAKQSNCTLPEDIVKDHELIVDCLREVPLEELMSEAINTPSYLTAFGPSVDGVVVKTDYAKELLTYFIPNDLQGFTSVSGVNNFKADKRSGDRIFGIRGGQNKYDLLFGVVTSEALWKFSAQDIQNGFEGERRDRIIRTYVRNAYTYHLSEIFFTIVNEYTDWERTVQHPINTRDAAVLAISDAQYVAPLVQTGDFLSVAKSSPDSGPNTFFYVFDYQTKDGDYPQRMGSVHGEELPYLFGAPLVEGLGHFPKNYTKSEVALSESFIQYIANFGRSG

Summary

EMBL
BABH01029677    KY021888    AQY62777.1    AGBW02014763    OWR41088.1    GEYN01000074    + More
JAV02055.1    KQ460154    KPJ17231.1    KQ459581    KPI99129.1    KZ150139    PZC72958.1    ODYU01003066    SOQ41368.1    JTDY01004463    KOB68129.1    NWSH01000461    PCG76243.1    KB631852    ERL86728.1    APGK01037776    APGK01037777    APGK01037778    KB740949    ENN77152.1    NEVH01000259    PNF43765.1    KQ971342    KYB27544.1    KK852665    KDR18954.1    NWSH01000115    PCG79397.1    ODYU01001227    SOQ37150.1    KP308206    ALH43424.1    GBBI01003238    JAC15474.1    AGBW02008258    OWR53904.1    BABH01029721    BABH01029722    BABH01029723    BABH01029724    KY021889    AQY62778.1    KZ150096    PZC73599.1    PYGN01000971    PSN38825.1    KZ288193    PBC34130.1    KPI99135.1    KQ461187    KPJ07360.1    KQ435007    KZC13423.1    KQ980509    KYN15773.1    AXCM01014898    QOIP01000007    RLU20424.1    ADMH02000570    ETN65853.1    DS235124    EEB12234.1    KK107238    EZA54825.1    AXCN02000220    KQ982727    KYQ51589.1    KQ977231    KYN04733.1    APCN01002110    KQ976697    KYM77528.1    ADTU01020531    ADTU01020532    ADTU01020533    ADTU01020534    ADTU01020535    ADTU01020536    ADTU01020537    ADTU01020538    KQ981676    KYN38135.1    JXUM01058211    JXUM01058212    JXUM01058213    KQ561992    KXJ76967.1    AAAB01008879    EAA44773.5    AJVK01025765    AJVK01025766    FJ580050    ACM48188.1    GGMS01006704    MBY75907.1    DS232169    EDS36558.1    UFQT01002602    SSX33753.1    GGMR01018148    MBY30767.1    GBYB01013771    JAG83538.1    CVRI01000047    CRK98256.1    UFQT01000426    SSX24215.1    RSAL01000099    RVE47584.1    CH940650    EDW66773.2    CH916373    EDV95063.1    JRES01001389    KNC23200.1    KJ702186    AID61340.1    CH933806    EDW15559.2    KRG01620.1    KRG01621.1    KRG01622.1    OUUW01000008    SPP83978.1    CM000070    EDY68564.3    CH902617    KPU79345.1    KQ435701    KOX80400.1    KQ415081    KOC58821.1    GL440822    EFN65349.1    GBHO01037920    JAG05684.1    NNAY01000326    OXU29206.1    ACPB03019970    ACPB03019971    ACPB03019972    GEBQ01006118    JAT33859.1    KQ768634    OAD53096.1    ABLF02028368    AJWK01025848    AJWK01025849    AJWK01025850    AJWK01025851    AJWK01025852    AJWK01025853    AJWK01025854    AJWK01025855    CP012526    ALC46886.1    GEZM01006945    JAV95539.1    KYB27546.1    ACPB03005614    KZ150175    PZC72572.1    GL452201    EFN77791.1    GL888172    EGI66119.1    ADTU01020508    ADTU01020509    ADTU01020510    ADTU01020511    ADTU01020512    GBBI01002710    JAC16002.1    KYN04724.1   
Pfam
PF00135   COesterase
Interpro
IPR002018   CarbesteraseB        + More
IPR029058   AB_hydrolase       
IPR019819   Carboxylesterase_B_CS       
IPR000460   Nlgn       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
3BIX     E-value=2.23136e-36,     Score=381

Ontologies

Topology

Length:
353
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.62886999999998
Exp number, first 60 AAs:
4.4901
Total prob of N-in:
0.18754
outside
1  -  353
 
 

Population Genetic Test Statistics

Pi
212.23243
Theta
188.697841
Tajima's D
0.434646
CLR
0.044375
CSRT
0.496825158742063
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号