SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09328
Annotation
PREDICTED:_uncharacterized_protein_LOC101745010_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.9 PlasmaMembrane   Reliability : 2.366
 

Sequence

CDS
ATGCCAGATTCACTGTGCGCATGCGCATTGGAACAGCAGTGTTTTAAGACGGTATGTAATCAGCAGCCCACTAAAACTATATTGCTTGGTACAGCGATATGCAATATTATGGACAATTCAGGCACGTTCTTGAGTACTGCCCGAATATTGGTAGATAGTGCATCGCAACGAGATCTGATTACTCTTGAATTTTGTAAGAGACTTAATTTACCAATTTATCCTTCCGAAACAAAGCAAGTGTGCGGAGTGGGTGATGTGAAAAATTCCATTGAAGGATATTGTTGTCTAACACTTTGCTCTTGTACTGAAGAATCAGTACGTATTACAATACAACCTCTGGTAATCAATAAAATTACAGGTGAACTTCCTACCTCAAAGATCGATACTTCAAGTCTTAATTATCTAAAACACATTAAGCTAGCTGATGACAGATTCTCACAGCCTAGTGGTATAGATTTGATTGTGGGTTCCGATGTATTCTCTCGAATTTTACGACCTCATATAATTTCTAGGGCCCCCGGTGAACCTGTAGCAATTGAGACTTCATTAGGTTACATAATAGTCGGCCAGGCACCGGTATTAGCTCCATCGATAGATAATTCATACTATACACATTGCACCTTTGGTGAGGACAATTTGGATAATGAGAATAATGCTTGTATTGGTAATTTTTTGAAATTAGAGGATATTCCAGACGTCAAGCCATACACGGAACAGGAAGAGGAGTGTGAAAGCCTTTATAGACAAACAACTACTCGTGATAGCTTAGGTCGTTACATTGTCTCGTTACCATTCAAAGATACTCCTAGTAAGCTGGGTGACTCATTACAGGCATCAATGCGTAGATATCTTTCATTGGAACGTAAGCTGCTATTGCAACCCGAAATGAGACAAGAATACGATAAAGTCATTAAGGACTATTTAGAAAAGGGATATTTAAACCCATGTTCTAGAAATATAAATGAGTCCTCACTCCAGTATGTTATTCCCCATCACGGCATCGTTCGAAAGGATAAAAGTACAACAAAATTACGGGTAGTATTGGATGGCAGTATGAAATCATCATCGGGACTGGCACTGAATGATATATTACAAGTCGGACCGAATTTGCAAAACGACCTTTTTAGAATAATTTTAAATTTCAGACTTTTTAATGTAGCGATTAGTGCCGACATTAGGCAAATGTACTTGAGGATTTTAGTAAAGGGCGAAGATAGGAAATTCCTGAGAATGTTGTATCGCTTTGATCCAAGCGAGGAGATAAAACTTTACGAATTCACACGTGTGCCATTCGGTTTGTGTTGTAGTCCGTTCCTTGCGATCAGGACTGTGCGCCAGTTAGTGACGGACGAGGGATCACAATTTCCTCTCGCGGCTCCAGTAGCTGACAGTGACGTTTTCACTGACGATTTGGCTACTTCCTGTGCGAATGAAGAAACAGCGGTCGAACTTTCTAATCAACTTATTAAAATGTTTCATGCTGGTGGTTTTGATTTGGTAAAGTTTTCAAGTAACTCACCAGAGGTTCTTTCTAAGATACCCTCTTCACATAGAGAATTCGAAGTTATAGAATTTAGTCCAGATAGCTATTTAAAAATACTGGGACTAAACTGGCTTCCAGCCGAAGACGTATTCACATTCACAGTAAATTTACGGAACCGCGAATGTACTAAAAGAAATATTTTATCAGTTATAGCAAGAATATGGGACTTAATGGGATTCGTAGCTCCTGTTACACTATGGGCCAAGCTCATCATTAAGTCACTATGGGCTAATAATATAGATTGGGATGAAACTCCTCGCCCTGAAATTGTAGCAGCTTGGCATCGATTCGTGTCTGAGTTGCCAATATTGGAAAATGTTAGAATACCACGACATACTGGCATTGTTATAGAGTGCATAGTTAGCTTATTGGGATTTGCTGATGCATCTGAAAAGGCCTATGGAGGTGTCGTTTATTTACATGTTTATTTTCCACAAACAAATAAGTTCACTATTACGCTTGTTTGTGCCAAATCCAGAGTAGCGCCGTTACGATGCGTGTCATTGGCAAGACTAGAATTATGCGGTAACTTGATTCTCGCAAAGTTGATGAGAGCAATTATTGACAGCTATTCTCATCGCTGTAAAATAAGTAATGTATTTGCCTTTACGGATAGCACCGTGGCTTTGGCATGGATTCACTCATCACCGGCTAGATGGCATACGTTTGTAGCCAACCGAGTAACAAAGATACAGGATGAAATACACCCCAGAAACTTTTATTTTGTATCGGGTAAAGAGAATCCAGCAGACTGTCTTTCACGCGGCTTAACACCATCACAATTGATGGAGCATCCTCTTTGGTTCAGTGGACCCCGATTTGCTCATCTACACATTTCAGATTGGCCAGTTAAGAATTTTGATGCCACATCGATGACTGATATTCCAGAAATGAAACCAGCTATCATGCTATTCACAACTGATGATGCACGGAATGACAATATATTATACACGCTTGCATGTCGTATTTCATCATGGCCCAAGCTGGTCCGTATTGTACTTTATGTTCTCCGGTTTATTAAATTGGTACCGAGTAAATTTGATATTTCCCATTTAAAGGTGGCCGAAACGAATATCATCAAGGCTGTACAGCGAGTTCACTTTGATAAAGAACTTAAGAATGTGAAGTCTGGCAAAATATTACCGCCTGCATTTCAACGGCTCAGAGCCTTTGTTCACGAAGGTATCTTTCGTGTTGGCGGGCGATTGGAGAATGCTCACTTGGAATTTGATAGTCAGCACCCTATTTTACTTCCCGCTCGTGACCATGTAGTGAACCTTTTGATAGACTATTATCACAAAAAGTATTTGCACACCGGACCGCAGCTCTTAATGTCTCTGATACGCCAAAACTACTGGATTCTCTCTGCTCGGAATATAATAAGAAAGCGAGTACAGCAGTGTAATATATGTTATAGAGCAAATCCCCGAAACCAATGTCCATTGATGGCTGATTTACCTGCTTGTAGAGTTCAAGAAACAAAGGCCTTTTATCACACTGGTATAGATTACGCTGGCCCATTACGTATTATTCCCTACAGGCGACGTGGTGTTCGTAGTCAAAAGGCGTATATTTGTCTGTTCATTTGTCTAGTTACCAAGGCAGTTCACCTAGAACTCTCAACGGACTTGAGCACAGCAGCTTTCCTGAATGCCTTCAAACGCTTCATTGCGCGGCGTGGTCCAATCAAAGTGGTCTATACCGACTGTGGAACAAACTTTTTGGGAACTCACTCATATCTCAAGGAAATGTATAAATTGATTTCCTCTGAGCAGTATGCAGATAAATTTGCAAATGAATTGCGTGATAATAATATAGATTGGAAATTCAACCCACCATCAGCCCCTCATTTTGGCGGTATATGGGAGGGTAATATTCGGAGCGTTAAAACTCATCTTAATAAAATAGTTGGTAATCAGCTTCTCACTTTTGAAGAAATGTTGACTACACTTGCTCAAATTGAAGCATTATTAAATTCGCGACCTCTATCAGTTTTGAGTTCAGATCCATGTGACCCTCAAGCTCTTACTCCTGCACATTTTATAAACTTAACACCATTAAAATCACTACCTTCAGAAACGATAACGGAACATTCTAATCTCATCCAAAGGAAACGTATTGTAGACAGTTTGGTCCAGTCTTTTTGGAAAAGATGGAAACTTGAATATCTTAATACATTACAAGTTCGTAATAAATGGAAAAAAGATAGCACTCCTATTAAAACTGGCACAGTTGTACTGCTTCAATCTGAAAATAGTGCTCCTCTTAATTGGCCATTGGGTATAATAGAGGAAACTTTTCCGGGTCGTGATGGAGTTGTAAGGGTGGTTAACATTAGAACGAAAACTGGTACTTATCGTAGACCTGTTGTTAAGGTTTATCCTTTACCAACACAGTAG
Protein
MPDSLCACALEQQCFKTVCNQQPTKTILLGTAICNIMDNSGTFLSTARILVDSASQRDLITLEFCKRLNLPIYPSETKQVCGVGDVKNSIEGYCCLTLCSCTEESVRITIQPLVINKITGELPTSKIDTSSLNYLKHIKLADDRFSQPSGIDLIVGSDVFSRILRPHIISRAPGEPVAIETSLGYIIVGQAPVLAPSIDNSYYTHCTFGEDNLDNENNACIGNFLKLEDIPDVKPYTEQEEECESLYRQTTTRDSLGRYIVSLPFKDTPSKLGDSLQASMRRYLSLERKLLLQPEMRQEYDKVIKDYLEKGYLNPCSRNINESSLQYVIPHHGIVRKDKSTTKLRVVLDGSMKSSSGLALNDILQVGPNLQNDLFRIILNFRLFNVAISADIRQMYLRILVKGEDRKFLRMLYRFDPSEEIKLYEFTRVPFGLCCSPFLAIRTVRQLVTDEGSQFPLAAPVADSDVFTDDLATSCANEETAVELSNQLIKMFHAGGFDLVKFSSNSPEVLSKIPSSHREFEVIEFSPDSYLKILGLNWLPAEDVFTFTVNLRNRECTKRNILSVIARIWDLMGFVAPVTLWAKLIIKSLWANNIDWDETPRPEIVAAWHRFVSELPILENVRIPRHTGIVIECIVSLLGFADASEKAYGGVVYLHVYFPQTNKFTITLVCAKSRVAPLRCVSLARLELCGNLILAKLMRAIIDSYSHRCKISNVFAFTDSTVALAWIHSSPARWHTFVANRVTKIQDEIHPRNFYFVSGKENPADCLSRGLTPSQLMEHPLWFSGPRFAHLHISDWPVKNFDATSMTDIPEMKPAIMLFTTDDARNDNILYTLACRISSWPKLVRIVLYVLRFIKLVPSKFDISHLKVAETNIIKAVQRVHFDKELKNVKSGKILPPAFQRLRAFVHEGIFRVGGRLENAHLEFDSQHPILLPARDHVVNLLIDYYHKKYLHTGPQLLMSLIRQNYWILSARNIIRKRVQQCNICYRANPRNQCPLMADLPACRVQETKAFYHTGIDYAGPLRIIPYRRRGVRSQKAYICLFICLVTKAVHLELSTDLSTAAFLNAFKRFIARRGPIKVVYTDCGTNFLGTHSYLKEMYKLISSEQYADKFANELRDNNIDWKFNPPSAPHFGGIWEGNIRSVKTHLNKIVGNQLLTFEEMLTTLAQIEALLNSRPLSVLSSDPCDPQALTPAHFINLTPLKSLPSETITEHSNLIQRKRIVDSLVQSFWKRWKLEYLNTLQVRNKWKKDSTPIKTGTVVLLQSENSAPLNWPLGIIEETFPGRDGVVRVVNIRTKTGTYRRPVVKVYPLPTQ

Summary

EMBL
GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    GEZM01085145    GEZM01085143    + More
JAV60187.1    GALX01004947    JAB63519.1    GEZM01054765    JAV73413.1    ABLF02030854    ABLF02067347    LBMM01009202    KMQ88311.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    ABLF02006304    ABLF02036268    GGMR01002421    MBY15040.1    GEBQ01000825    JAT39152.1    GEBQ01015458    JAT24519.1    GFTR01008866    JAW07560.1    ABLF02008594    ABLF02030698    ABLF02030705    ABLF02030709    ABLF02039606    GGMS01010524    MBY79727.1    ABLF02041863    GGMR01017890    MBY30509.1    LNIX01000007    OXA51795.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LNIX01000069    OXA36894.1    LNIX01000016    OXA46198.1    LNIX01000002    OXA60848.1    GBBI01004211    JAC14501.1    ABLF02036131    ABLF02041527    ABLF02064049    LBMM01009551    KMQ88039.1    KK114194    KFM61875.1    OXA59522.1    GBHO01044643    JAF98960.1    ABLF02035780    GBRD01007977    JAG57844.1    ABLF02025193    GGMR01018294    MBY30913.1    GDHC01016727    JAQ01902.1    GDHC01006469    JAQ12160.1    GBHO01007061    JAG36543.1    JXUM01113346    KQ565681    KXJ70776.1    GGMR01013370    MBY25989.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    GGMR01016460    MBY29079.1    ABLF02005684    GBHO01028371    GBHO01028370    JAG15233.1    JAG15234.1    GBBI01004408    JAC14304.1    GBBI01004410    JAC14302.1    GDHC01014057    JAQ04572.1    LBMM01009645    KMQ87967.1    GFTR01008874    JAW07552.1    GBHO01007689    JAG35915.1    GGMR01018506    MBY31125.1    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    GGMS01014951    MBY84154.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GDHC01014268    JAQ04361.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GGMR01010750    MBY23369.1    LNIX01000036    OXA39969.1    LBMM01008464    KMQ88855.1    LBMM01010417    KMQ87475.1    ABLF02008636    ABLF02065931    LBMM01007859    KMQ89359.1    LBMM01010405    KMQ87487.1    ABLF02042806    GBHO01023090    JAG20514.1    GGMS01006636    MBY75839.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    LBMM01009964    KMQ87756.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    KQ458473    KPJ05885.1    LNIX01000018    OXA45284.1    GGMR01014165    MBY26784.1    ABLF02028666    ABLF02066713    GGMR01014351    MBY26970.1    LBMM01012188    KMQ86362.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    CR954257    CAJ14165.1    GGMS01012379    MBY81582.1   
Pfam
PF00665   rve        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF03564   DUF1759
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR021109   Peptidase_aspartic_dom_sf       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR001878   Znf_CCHC       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
1313
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0954799999999997
Exp number, first 60 AAs:
0.01559
Total prob of N-in:
0.00121
outside
1  -  1313
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.408225
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号