SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09318
Annotation
PREDICTED:_uncharacterized_protein_LOC105842439_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 3.598
 

Sequence

CDS
ATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGQALPRELLEPPAMVR

Summary

EMBL
AGBW02012184    OWR45487.1    RSAL01000708    RVE41206.1    ABLF02017815    RSAL01000536    + More
RVE41424.1    ABLF02049496    ABLF02066620    ABLF02029291    ABLF02016515    ABLF02016517    ABLF02041765    APGK01020047    KB740155    ENN81216.1    ABLF02008463    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02023911    GEZM01074951    JAV64378.1    ABLF02021994    GALX01005359    JAB63107.1    ABLF02008677    ABLF02011967    ABLF02052409    ABLF02056408    ABLF02041767    GGMS01013269    MBY82472.1    ABLF02015272    ABLF02016494    ABLF02066976    GGMS01004685    MBY73888.1    ABLF02034467    ABLF02003375    GECZ01011980    JAS57789.1    ABLF02021177    ABLF02027367    ABLF02066338    APGK01055369    APGK01055370    KB741264    ENN71543.1    KK113014    KFM59099.1    ABLF02026276    KB631186    ERL84155.1    ABLF02061876    ABLF02030700    ABLF02033522    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02042518    ABLF02057746    APGK01045324    KB741033    ENN74747.1    ABLF02003699    ABLF02003700    ABLF02007662    ABLF02007663    ABLF02019401    ABLF02049974    ABLF02050034    ABLF02004189    ABLF02005775    ABLF02015592    ABLF02057149    ABLF02058897    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02046613    KK117880    KFM71667.1    ABLF02030319    ABLF02030320    ABLF02060395    GGMS01014520    MBY83723.1    ABLF02055645    ABLF02025082    ABLF02039175    ABLF02041809    ABLF02061874    ABLF02034494    KB632420    ERL95312.1    ABLF02010251    ABLF02035981    GGMR01019198    MBY31817.1    ABLF02052197    ABLF02029306    ABLF02029314    ABLF02060138    GALX01005300    JAB63166.1    ABLF02003961    ABLF02059872    GGMS01012005    MBY81208.1    GGMR01004661    MBY17280.1    GALX01005299    JAB63167.1    ABLF02019349    ABLF02041900    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    ABLF02017810    ABLF02017816    KK115079    KFM64119.1    KB631851    ERL86724.1    ABLF02017659    ABLF02017667    ABLF02065648    ABLF02014933    ABLF02014938    ABLF02003739    ABLF02003740    ABLF02008933    GGMS01014127    MBY83330.1    GBHO01041572    GBHO01041570    GBHO01010553    JAG02032.1    JAG02034.1    JAG33051.1    NEVH01013579    PNF28469.1    KK116737    KFM68634.1    KK116883    KFM69009.1    KQ971370    EFA09320.1    ABLF02062685    KB632361    ERL93526.1    GEZM01008457    JAV94772.1    GGMR01000167    MBY12786.1    KB632400    ERL94892.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBBI01004571    JAC14141.1    ABLF02042106    KQ459265    KPJ02064.1    KQ459259    KPJ02068.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF05485   THAP
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR006612   THAP_Znf       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
212
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.21305
Exp number, first 60 AAs:
0.05743
Total prob of N-in:
0.02506
outside
1  -  212
 
 

Population Genetic Test Statistics

Pi
369.678885
Theta
199.629192
Tajima's D
2.609385
CLR
0
CSRT
0.952952352382381
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号