SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09316
Pre Gene Modal
BGIBMGA006890
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_isoform_X1_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.967
 

Sequence

CDS
ATGGCAACAAATAACAACGAAGCAGTCTCCGGTATTAAACCACCCGGATACTTGCACATCGAGTCGGACAACAAGTCGGCAAATTGGAAAAAATGGCGACAACAGTTCGAATGGTATGCAACAGCAATTCAGCTAGGAAAGAAACCTGCCGATATTCAAGCTGCAACATTCATGTCAATCATAGGACCAGATGCAATTGACATCTACAACAGTTTTAATTTGAATACAATAGACGAACAAAAATTAAGCATCATTATCGGAAAGTTCGAAGAATATTTCGCGCCGAAAAACAACATATCGTTCGAAAGGTATGTTTTCTTCAAAATTGAACAACATGAAGACGAATCGTTTAACGAATTCATCACTAGAATTAAAACACAAGCAAACAAATGCGAGTTTGGCACTCTACTTGAAGAAATGCTAAAAGACAAGATTGTATTCGGAATAAAATCAACCCAAATCAGAGAAAAATTACTCACCGAAGAAAAACTTGATCTCACAAAAGCCACAGCCATCTGTAAAAGCAGTGAACAAGCTTCCAAACAACTTAACGAGTTTGAGAATAACAACAAGAGTGAAAAAATACTGACAATCAAAAGTAAGAACTTCAGAAATGAAAAATTTGACTGTAAAAGATGTGGTTCAAGCCACAAGGCTAGAGAATGCCAAGCCTACAACAAATTATGCACAAAGTGTAACAAGGCCGGTCATTTTGCAAAAATGTGTCGTTCCAAAATTCAATTGAAACAAAAAAATAAAATAAATACTCTAGAAGAAAATTCTACATCAGAAAATTCAGATGAATCATTTATAGGACAATTAAGTGTCGGCAACTCCAAAGATTGGACAGAAAGTGTCGAAACTGCCAACACAAAATTCACAGCAAAGCTTGATACTGGTGCAGAGTGCAACGTCCTTCCAAATTTCATAGTACAGAAAACTCACGCTTGTATACAACCAAGTCGCACTAAAAATTTAATAAGTTATTCAAATAACAGAATTTCAGTACTTGGAGAAGTAAAGTTACAATGCAAAATAAAAAAGAAAACTGCTAAAATACTATTTAAAGTTGTAGCTGAAAGAGTCACACCAGTCTTAGGACTAAACACTTGTGAGAAGCTGGGACTAATTGCACGAGTTGAAACATTGAAAGAAAGCTCATCCAATGATGACATATTTAAAGGGTTAGGTTGCTACAAAAATTTTGAGTATGATATTGACCTCATAGAAAACCCCAAATTTGAAATAAAACCAACAAGAAAAGTTCCACATGCCATAAGAAATGAAGTAAAACAAGAATTAGATAGAATGGTAAAACTGGATGTCATCACACCTGAAACAGAACCGACACCAGCAGTAAGTCCGATGGTGGTAGTCAGACAAAAAGGAAAATTGAGAATATGCATCGACCCATCAGATGTGAACAAAAATATTTTAAGAAGACATTTCCCACTTGCAACAATAGAAGAGATAGCAGCAGACATCAAAGGATCAGAATATTTTTCCCTACTAGACTGCACCAAAGGATTTTGGCAAATTAAATTATCAAAAAGAACACAAAAGATACTGACATTTTCTACACCATGGGGAAGATATTCATTCAAAAGACTTCCATTTGGACTATCGTCAGCCCCTGAAATTTTTCAAGAAATCTTGACTAATCTTCTCAGCAAATTCAGAAATGTAAAAGTATCAATCGATGATATCTTTATTCATGCCAAAAAGAAGGAAGAGCTACAGAAAACGGTCAAAGAAGTAATAGAGACATTGAAAATTTCTGGCTTCAAACTCAATCAAAGCAAATGCATCTTTGAAGCCAAAAGAATAAAATTTTTGGGTCATATAGTCTCAGCCAAAGGCTTAGAAGCAGATCCTGAAAAAGTAAAAGCCATAGAATTCATGAAAACACCACAGAACAAAAAAGAACTGCAAAGGATACTAGGAATGATAACATATTTAAATAAATACATTCCCAACATGTCAGAATTAACAAACCCTTTGAGAGACCTACTTCACAAGGACACAAGTTTCAACTGGGAATTCTATCATGATGAAGCACTCAACAAAATTAAAAAAGTCTTACAGAATCCACCAGTGCTAAAACTATATGATGTAAACAAACCAGTCACACTAAGCGTGGATGCAAGCTCAAAGAATCTTGGTGCAGCACTTCTTCAGGAAGGCCAACCAGTAGCTTATGGAGCCAGAACATTGACTAAATCCGAACAAAACTACCCTCAAATTGAAAAGGAAGCACTTGCTATACTATTTGGGTGCAAAAAGTTCCATGAGTATGTCTATGGCAAAGAGTTATTAGTCGAATCAGATCACAAGCCGCTCGAGACAATATTCAGAAAAAACATTCAGTCAGCCCCAGCTAGACTTCAACGTATAATGCTCAACCTAACACCGTATTCACCAAAAATTACATTTAAAAAAGGCACAGAAATACCACTAGCAGACTTTTTAAGTCGTGATTGTGACACTTCAAAACTGAATGACTATCAGGAAGAAGACCTGAAGATCTCAATAATATTACCAACAACATTTGACTACACAGAAGAGTTGATCAAAGCAACAAAAGAAGACCCCCACCTGCAACTCTTGTTAAAAACAATAATGAAAGGGTTCCCAGAAAAGGCTGATCAACTCCCTACAGAATTGCATCACTACTTCAATTTCAAAGAAGAACTAACATACTTCAAAGGTCTAATTTTCAAAGGTCACAAAATTGTAGTGCCCAAAACACAAATACCTCAGATGCTAAAATACATACACCAAGGTCACCTTGGAATTCAGAGTTGCTTGAAAAGAGCACACCAATTACTCTATTGGAGAGGACAATATGAAGACATTGTGAAACTGGTTAAAAGCTGCTCAGCATGTGAAAAAACACAAAAGGACAATACCAATTATACCGTAGCAGTCAAAAGAATCCCATCTCTCCCATGGCAGATTGTGGCATCTGATTTATTTGAACTAAAAGGAAAACAGTATATTGTAATCTGTGACAGCTATTCAGGATACTTAGACTTTCAGTCACTTAAGAGCTCATCATCAACTGAAGTGATTAATCACTTAAAACAATGGTTCTCTACACATGGAATACCTGAAGTACTTGAATCAGACAACGGTCCACAGTACATGTCCAGAGAATTCAAAGATTTCCAGAAAGAATGGCGTTTCAAGCACTCAACATCCAGTCCTCACCACCCCCAAGGCAATGGCTTAGCCGAAAGAGCTGTCCAAACTGCAAAAAACCTACTAAGGAAATGCAGTATTGATAAATCGGATATCCAACTTGCTCTATTAAATTGGAGAAATACACCAAGAACAAACAATCTAGGGTCTCCTAATCAACGCCTCTACAGTAGAATAACACGATCACTAATACCTACAAGTGAAAATAATCTTAAACCAAAGATAGTTCAAGGGGTCACATCTGAACTAAAGTACCTACGAAACAAACAAGCCAACCATAGCAACAAGCAACGTAAGGAGCCAACCAATTATGAACTCGACGACATAATCAGACACAAAGTCGGTCATCGTCAATGGGAAGGAGCGAGAGTGATAGAAAAACCTAATAATCACCCGAGATCCATTATCATTAAAACCGACAAAGGACAAATATTCAGAAGAAACATTGGACACACACACAATACACTATCAGACCTATCAATTGGCAGCAAAGAAGCGGTTCCGGAAACAGTATATCCTGACGACTTACCACATGCCCAATCGGACAAACAACCGGAGCTACCTGCAGCAACTACTACATCTCAAGAACAAACAACTACATCACCAAGGATTAATTGCAAAAGCAGCGCTTCAGAAGCACCCGTCATAACTAGCAGTGATCAACAGACTACAAGATGTTCAAGATTCGGAAGAACCATCAAACCAGTCGACAGACTAGATCTATAG
Protein
MATNNNEAVSGIKPPGYLHIESDNKSANWKKWRQQFEWYATAIQLGKKPADIQAATFMSIIGPDAIDIYNSFNLNTIDEQKLSIIIGKFEEYFAPKNNISFERYVFFKIEQHEDESFNEFITRIKTQANKCEFGTLLEEMLKDKIVFGIKSTQIREKLLTEEKLDLTKATAICKSSEQASKQLNEFENNNKSEKILTIKSKNFRNEKFDCKRCGSSHKARECQAYNKLCTKCNKAGHFAKMCRSKIQLKQKNKINTLEENSTSENSDESFIGQLSVGNSKDWTESVETANTKFTAKLDTGAECNVLPNFIVQKTHACIQPSRTKNLISYSNNRISVLGEVKLQCKIKKKTAKILFKVVAERVTPVLGLNTCEKLGLIARVETLKESSSNDDIFKGLGCYKNFEYDIDLIENPKFEIKPTRKVPHAIRNEVKQELDRMVKLDVITPETEPTPAVSPMVVVRQKGKLRICIDPSDVNKNILRRHFPLATIEEIAADIKGSEYFSLLDCTKGFWQIKLSKRTQKILTFSTPWGRYSFKRLPFGLSSAPEIFQEILTNLLSKFRNVKVSIDDIFIHAKKKEELQKTVKEVIETLKISGFKLNQSKCIFEAKRIKFLGHIVSAKGLEADPEKVKAIEFMKTPQNKKELQRILGMITYLNKYIPNMSELTNPLRDLLHKDTSFNWEFYHDEALNKIKKVLQNPPVLKLYDVNKPVTLSVDASSKNLGAALLQEGQPVAYGARTLTKSEQNYPQIEKEALAILFGCKKFHEYVYGKELLVESDHKPLETIFRKNIQSAPARLQRIMLNLTPYSPKITFKKGTEIPLADFLSRDCDTSKLNDYQEEDLKISIILPTTFDYTEELIKATKEDPHLQLLLKTIMKGFPEKADQLPTELHHYFNFKEELTYFKGLIFKGHKIVVPKTQIPQMLKYIHQGHLGIQSCLKRAHQLLYWRGQYEDIVKLVKSCSACEKTQKDNTNYTVAVKRIPSLPWQIVASDLFELKGKQYIVICDSYSGYLDFQSLKSSSSTEVINHLKQWFSTHGIPEVLESDNGPQYMSREFKDFQKEWRFKHSTSSPHHPQGNGLAERAVQTAKNLLRKCSIDKSDIQLALLNWRNTPRTNNLGSPNQRLYSRITRSLIPTSENNLKPKIVQGVTSELKYLRNKQANHSNKQRKEPTNYELDDIIRHKVGHRQWEGARVIEKPNNHPRSIIIKTDKGQIFRRNIGHTHNTLSDLSIGSKEAVPETVYPDDLPHAQSDKQPELPAATTTSQEQTTTSPRINCKSSASEAPVITSSDQQTTRCSRFGRTIKPVDRLDL

Summary

EMBL
MRZV01000618    PIK46835.1    MRZV01000576    PIK47528.1    ABLF02013930    ABLF02013934    + More
HADY01023773    HAEJ01006887    SBS47344.1    HAEH01020882    SBS11479.1    GBGD01000115    JAC88774.1    GBGD01000119    JAC88770.1    HADZ01002490    HAEA01007842    SBQ36322.1    GEGO01004116    JAR91288.1    GBHO01004090    JAG39514.1    GEGO01004317    JAR91087.1    GDHC01013957    JAQ04672.1    GCES01096219    JAQ90103.1    KK112400    KFM57554.1    GBBI01004745    JAC13967.1    GEZM01041944    JAV80090.1    AAGJ04164197    MRZV01000033    PIK61397.1    ABLF02022355    ABLF02022359    ABLF02022361    ABLF02022365    ABLF02041467    GEZM01074317    JAV64601.1    GDHC01017753    JAQ00876.1    AAGJ04066141    AAGJ04126635    GBHO01036465    JAG07139.1    GEZM01035137    JAV83383.1    GGMR01004179    MBY16798.1    AAGJ04172695    GEZM01011167    JAV93617.1    GDIP01203362    JAJ20040.1    GDIP01199810    GDIP01181260    GDIP01124130    GDIP01104931    GDIP01053137    GDIP01051184    JAL98783.1    GDIP01019161    JAM84554.1    GDIP01102077    JAM01638.1    KF319019    AIE48224.1    GDIP01239061    JAI84340.1    GDIP01156216    JAJ67186.1    AAGJ04068764    GEGO01003204    JAR92200.1    ABLF02041541    GBHO01022049    GBHO01022048    JAG21555.1    JAG21556.1    GDIP01073678    JAM30037.1    AAGJ04132660    GDIP01096578    JAM07137.1    GDIP01175260    GDIP01109876    JAL93838.1    GDIP01017210    JAM86505.1    HAEH01011921    SBR93481.1    GEGO01004733    JAR90671.1    GEZM01001973    JAV97431.1    GEZM01066276    JAV68015.1    GDIP01175266    GDIP01109877    JAL93837.1    GDKW01000526    JAI56069.1    GEGO01004841    JAR90563.1    HADY01017769    SBP56254.1    ABLF02066184    ABLF02066704    AAGJ04099771    GDIP01192261    JAJ31141.1    MRZV01002352    PIK33923.1    RQTK01000162    RUS85701.1    GEFM01006311    JAP69485.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF03732   Retrotrans_gag
PF00098   zf-CCHC
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR005162   Retrotrans_gag_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=1.71714e-49,     Score=500

Ontologies

Topology

Length:
1308
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00374
Exp number, first 60 AAs:
0.00173
Total prob of N-in:
0.00018
outside
1  -  1308
 
 

Population Genetic Test Statistics

Pi
311.720853
Theta
167.718635
Tajima's D
2.459667
CLR
0
CSRT
0.937853107344633
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号