SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09289  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA003428
Annotation
PREDICTED:_dolichyl-diphosphooligosaccharide--protein_glycosyltransferase_subunit_STT3A_[Papilio_machaon]
Location in the cell
PlasmaMembrane   Reliability : 4.949
 

Sequence

CDS
ATGACGGCGGAAACACAGAGCAAGTCCAGATTACCGTATTTGTCTTCGGACAAACAACTAACATTTATAAAACTCTCTGTATTGTCAATGGCAGCAATTTTATCTTTTGCGACGCGTTTATTCTCCGTTCTGCGTTTTGAGAGCGTAATCCATGAGTTTGATCCCTACTTCAACTATAGAACGACGAGATATCTCACTGAAGAGGGATTTTATAACTTCCACAACTGGTTTGACGATAGAGCATGGTATCCTCTAGGTCGTATTATTGGAGGTACCATCTACCCTGGCCTGATGGTGACTTCTGCCACTCTTTACAATATAATGCAGTACTTAAACATAACAATTGACATCAGAAATGTATGTGTGTTCTTGGCTCCATTCTTCTCCTCACTCACAACTATTGTCACATACCTCCTTACCAAGGAGTTAAAGAATGAAGGAGCGGGCTTAGTGGCAGCAGCAATGATTGCAATCGTCCCTGGTTACATCAGTCGTTCAGTCGCAGGAAGCTATGATAATGAAGGCATCGCCATCTTCTGCATGCTGCTGACTTATTATTTTTGGATCAAAGCTGTTAATACAGGAACTATCATGTGGGCAACTATGACGGCTCTGGCATATTTCTACATGGTGTCATCATGGGGTGGCTACGTTTTCCTCATAAACCTGATACCGTTGCACGTACTGGCCCTCATTCTGCTGGGAAGGTTCTCGTCGAGGGTGTACGTGGCTTACAGCACGCTGTACTGCATCGGAACCATCCTCTCAATGCAGATTTCTTTTGTGGGCTTCCAACCGGTGCAGAGTTCGGAGCATATGTTGGCTCTCGGTACATTCGGGCTGTGTCAGCTGTACGCGTTCACGCAGTACCTCAGACAACATCTGTCGCCGGCTAACTTCGAGCTGCTCTTCAAGGCTCTTGTTACAACGCTGCTTCTGACCCTGGGCTCTGCTATCATAGCCCTCACTTTGACCGGAAAAATCTCACCGTGGACTGGCCGTTTCTACTCATTGCTCGATCCATCGTACGCTAAGAACCACATTCCTATCATTGCATCCGTGTCCGAGCATCAGCCCACGTCGTGGTCATCATTCTACTTCGACCTCCAAGTCCTGGTGTTCCTGTTCCCGGCTGGACTGTACTTTTGCTTTAGCAAGCTCACGGATGCAAACATATTCATCATTCTGTATGGTGTGCTCAGTATATACTTTGCTGGCGTCATGGTTCGTCTTATGCTGGTACTCGCTCCGGTCATGTGCATCGTCTCCGGTATAGCAGCTTCCAGTCTACTTAGTCTTCACGTTAAGGATATTGAGCCTAAAGTTGAGAAACACGATAAGAAGAAGAAGCATGAAAATAATCTTGTGTTTAGATCTGAGGTGGGCACGTTGTTCGTGTGCGTGCTGGGCTGCCTGCTGGTGTCGTACGTGGTGCACTGCACGTGGGTCACGTCGGAGGCCTACTCGTCGCCCTCCATCGTGCTGTCGGCGCGCGCACACGACGGCGCCCGGATCATCTTCGACGACTTCCGCGAGGCCTACACCTGGCTCAAGATGAACACTCCAGAGGACGCCAAAGTGATGTCGTGGTGGGACTACGGCTACCAAATAACGGCGATGGCGAACCGGACGGTGATCGTCGACAACAACACGTGGAACAACACGCACATATCGCGCGTGGGGCAGGCGATGGCCTCCACCGAGGACAAGGCCTACGAGATCATGAGGGAGCTGGACGTGGACTACGTGCTCGTCATCTTCGGAGGACTGGTCGGATACTCTTCGGACGACATCAACAAGTTCCTGTGGATGGTGCGCATCGGCGGCAGCACGGAGCGCGGCGCGCACATCCGCGAGGCGCAGTACTACACGGCGGCCGGGGAGTTCCGCGTGGACTCGGCCGGCGCGCCCGCGCTGCTCAACTGCCTCATGTACAAGATGAGCTACTACAAGTTCGGACTCGTCTACACGGAGGGCGGCCGGCCGCCAGGGTTCGATCGGGTTCGAGGAGCTGAGATCGGCAACAAGGACTTCAATCTAGATGTTCTAGAGGAAGCCTACACGACAGAACATTGGCTGGTCCGCATTTACAAAGTCAAACCTTTGCCGAACAGGGGAGTATAA
Protein
MTAETQSKSRLPYLSSDKQLTFIKLSVLSMAAILSFATRLFSVLRFESVIHEFDPYFNYRTTRYLTEEGFYNFHNWFDDRAWYPLGRIIGGTIYPGLMVTSATLYNIMQYLNITIDIRNVCVFLAPFFSSLTTIVTYLLTKELKNEGAGLVAAAMIAIVPGYISRSVAGSYDNEGIAIFCMLLTYYFWIKAVNTGTIMWATMTALAYFYMVSSWGGYVFLINLIPLHVLALILLGRFSSRVYVAYSTLYCIGTILSMQISFVGFQPVQSSEHMLALGTFGLCQLYAFTQYLRQHLSPANFELLFKALVTTLLLTLGSAIIALTLTGKISPWTGRFYSLLDPSYAKNHIPIIASVSEHQPTSWSSFYFDLQVLVFLFPAGLYFCFSKLTDANIFIILYGVLSIYFAGVMVRLMLVLAPVMCIVSGIAASSLLSLHVKDIEPKVEKHDKKKKHENNLVFRSEVGTLFVCVLGCLLVSYVVHCTWVTSEAYSSPSIVLSARAHDGARIIFDDFREAYTWLKMNTPEDAKVMSWWDYGYQITAMANRTVIVDNNTWNNTHISRVGQAMASTEDKAYEIMRELDVDYVLVIFGGLVGYSSDDINKFLWMVRIGGSTERGAHIREAQYYTAAGEFRVDSAGAPALLNCLMYKMSYYKFGLVYTEGGRPPGFDRVRGAEIGNKDFNLDVLEEAYTTEHWLVRIYKVKPLPNRGV

Summary

EMBL
BABH01023963    KQ460106    KPJ17817.1    KZ149923    PZC77654.1    KQ459602    + More
KPI93603.1    RSAL01000026    RVE52063.1    NWSH01002254    PCG68805.1    ODYU01004261    SOQ43943.1    AGBW02015002    OWR40733.1    GECU01035466    JAS72240.1    GAIX01012071    JAA80489.1    KK852696    KDR18262.1    NEVH01026112    PNF14573.1    GFTR01007795    JAW08631.1    GDKW01001291    JAI55304.1    GBGD01000673    JAC88216.1    ACPB03005610    GAHY01000994    JAA76516.1    GBHO01006080    GDHC01021415    JAG37524.1    JAP97213.1    GBBI01000731    JAC17981.1    GEZM01062156    GEZM01062155    JAV70006.1    GEDC01011139    JAS26159.1    GDAI01001956    JAI15647.1    CH477296    EAT44394.1    GFDL01012654    JAV22391.1    GBXI01010334    JAD03958.1    GDHF01026345    GDHF01021502    GDHF01020799    JAI25969.1    JAI30812.1    JAI31515.1    GAKP01019581    GAKP01019580    GAKP01019579    JAC39372.1    JXUM01031403    JXUM01031404    JXUM01031405    KQ560920    KXJ80345.1    GDIP01009873    LRGB01000512    JAM93842.1    KZS18894.1    CCAG010020168    JRES01001642    KNC21261.1    GL732533    EFX84969.1    GDIQ01253686    GDIQ01253685    GDIQ01250989    GDIQ01247842    GDIQ01247841    GDIQ01243801    GDIQ01190607    GDIQ01190606    GDIQ01187906    GDIQ01186358    GDIQ01184710    GDIQ01178204    GDIQ01169506    GDIQ01166911    GDIQ01155622    GDIQ01148333    GDIQ01146872    GDIQ01140885    GDIQ01132492    GDIQ01132491    GDIQ01129888    GDIQ01127245    GDIQ01125532    GDIQ01123678    GDIQ01119271    GDIQ01119270    GDIQ01113587    GDIQ01100842    GDIQ01099431    GDIQ01099430    GDIQ01087842    GDIQ01087841    GDIQ01084602    GDIQ01079936    GDIQ01077987    GDIQ01050966    GDIQ01050965    GDIQ01049714    GDIQ01048211    GDIQ01046460    GDIQ01044469    JAK00736.1    QCYY01000659    ROT83643.1    ADMH02001666    ETN61504.1    GDIQ01231731    JAK19994.1    GBFC01000029    JAC59309.1    GDIQ01121085    GDIQ01121084    JAL30641.1    GDIQ01137774    JAL13952.1    JXJN01001849    JXJN01001850    CM000162    EDX03061.1    CH954180    EDV47584.1    GAMC01016454    GAMC01016453    JAB90101.1    BT032845    ACD81859.1    CH933815    EDW08029.1    KRG07558.1    KRG07559.1    AE014298    AAF50861.1    AGB95589.2    ATLV01014483    KE524974    KFB38788.1    GANO01001569    JAB58302.1    GDIQ01089836    JAN04901.1    KQ971342    EFA03010.1    GDIQ01035412    JAN59325.1    GDIQ01135120    JAL16606.1    KK107436    EZA50852.1    GDIQ01075487    JAN19250.1    CH964239    EDW82624.1    CH940651    EDW65640.1    AAAB01008846    EAA06273.4    CH480823    EDW56341.1    QOIP01000002    RLU26129.1    CH902640    EDV38394.1    OUUW01000003    SPP78055.1    KQ435821    KOX72428.1    GDIQ01214001    JAK37724.1    CH916370    EDW00492.1    JXUM01080880    JXUM01080881    KQ563214    KXJ74280.1    KQ759851    OAD62552.1    GL887888    EGI69724.1    KQ981906    KYN33291.1    ADTU01012795    KQ982548    KYQ55163.1    CP012528    ALC48548.1    KQ435127    KZC14801.1    KQ414727    KOC62475.1    GL435626    EFN72934.1    GGFK01001484    MBW34805.1    GAKP01019582    JAC39370.1    CH379065    EDY73182.1    KRT07199.1    GGLE01003620    MBY07746.1    KZ288215    PBC32548.1    GFWV01022456    MAA47183.1    NNAY01000097    OXU31004.1    AAZX01003235    AAZX01010155    AAZX01012906    GEBQ01022482    JAT17495.1    GBYB01008133    GBYB01014114    JAG77900.1    JAG83881.1   
Pfam
PF02516   STT3
Interpro
IPR003674   Oligo_trans_STT3       
PDB
6FTI     E-value=0,     Score=2642

Ontologies

Topology

Length:
707
Number of predicted TMHs:
13
Exp number of AAs in TMHs:
280.60402
Exp number, first 60 AAs:
21.90087
Total prob of N-in:
0.99686
POSSIBLE N-term signal
sequence
inside
1  -  20
TMhelix
21  -  43
outside
44  -  84
TMhelix
85  -  107
inside
108  -  119
TMhelix
120  -  137
outside
138  -  146
TMhelix
147  -  169
inside
170  -  175
TMhelix
176  -  198
outside
199  -  212
TMhelix
213  -  235
inside
236  -  241
TMhelix
242  -  264
outside
265  -  273
TMhelix
274  -  291
inside
292  -  302
TMhelix
303  -  325
outside
326  -  365
TMhelix
366  -  385
inside
386  -  391
TMhelix
392  -  409
outside
410  -  412
TMhelix
413  -  435
inside
436  -  455
TMhelix
456  -  478
outside
479  -  707
 
 

Population Genetic Test Statistics

Pi
260.091819
Theta
155.641224
Tajima's D
2.439144
CLR
0.326568
CSRT
0.936503174841258
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号