SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09288
Annotation
PREDICTED:_uncharacterized_protein_LOC101743030_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.258
 

Sequence

CDS
ATGGTCATTGAAGAGTTGCCACCCGGCCAACCACAGGAGAACCCACGGCACCCTAAGAGGGTAAGGGTGCTCTCTCCTATGGTCGCGAAACACCCAGGCACTAGCGGGGCCAGCACCCCGGTCATGGAGCGGCCCGGCACTAGCGGGACCAGCACCCCAGCCACCGAGCGGCCTGTTATCCCTTCGTCCTCTCGACCTCTTCCTCCTCCTCGCGAAGACGAAATTATGGCTCTGCTGAATTATGGCAGCGAAGAGGACTCTGAGGGAGAGGACGAAGATATTCTGCAGCCGCCGTTGGTTCCCCGGTCGACCAGGATGTGGCTGGACGAAGAGGATGAGGAAGTTGTACCAGAAGCGTAG
Protein
MVIEELPPGQPQENPRHPKRVRVLSPMVAKHPGTSGASTPVMERPGTSGTSTPATERPVIPSSSRPLPPPREDEIMALLNYGSEEDSEGEDEDILQPPLVPRSTRMWLDEEDEEVVPEA

Summary

Pfam
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD       

Ontologies

GO

Topology

Length:
119
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03412
outside
1  -  119
 
 

Population Genetic Test Statistics

Pi
413.745895
Theta
196.435277
Tajima's D
2.968186
CLR
0.534758
CSRT
0.977251137443128
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号