SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09264
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 1.041
 

Sequence

CDS
ATGGAATTGGATAGGACAACAGCTATCGGGGACCGCAGCAACCTGTGCTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCGCAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCTAAAAGGAAGGCTGACCACCGGGCCGGGGGCCCGGCGTGCAAGTCCGCCCCCTCCTCTACAAAAACGAGGAGGGGCGGAAAGAAAAAGAAGCCGGCTGCAACAAGGGCAGCCGGCGAGTCAGTTCCCGCCGCGGCTGTTGTCGAGCCGCAGGGCGGAACAGACGAGGGAGCGATGGATGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCTGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATGGGGGACGTCGACGGCTCCGTGGCCATTGTGTTGAGACAGTCCGCGGCGTTACCCCCCTTGGAAATGGTGGCCAGGGGACCCGGGTACGTCGCGGCTAGGATCGACGGGACCGTCGTGATCGGGGCGTACTTTTCTCCGAACAGGAGCCTCGCCGAGTTCGAGCGGTTTCTGGGCGGGCTCGAGGCGCTTTTACACCGCCTCGGGTCCCGCCCTGTCATCGTCGCGGGGGACTTCAATGCCAAGTGCACGGCTTGGGGTTCCCCCCGCACGGATGCGCGAGGCGAGGCCCTTTCGGAGTGGGCGATCGCGACCGGCCTCTGTCTCCTAAACAGAGGCACTGTCGCGACTTGCGTGCGGTGGAACGGGGAATCTCACGTGGACGTGACGTTCGCGTCCCCTTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGCGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGGATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGCGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCAAGACTCCGAGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACCGCCGCCGCCGTCGTCGCGACGCTGCGTTCGCGGAGACGGCGGCCCAGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCAGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGCGCCCATACAAGATGGGGACCGGCTCGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGACCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGATGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCGACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGTCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTAGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGCTCTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTTAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTTCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAAGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACGGCCTCCGTACGGCGCGTTGCTCTGGTTTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAG
Protein
MELDRTTAIGDRSNLCFRCGQPGHKAASCTAAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKKKPAATRAAGESVPAAAVVEPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWMGDVDGSVAIVLRQSAALPPLEMVARGPGYVAARIDGTVVIGAYFSPNRSLAEFERFLGGLEALLHRLGSRPVIVAGDFNAKCTAWGSPRTDARGEALSEWAIATGLCLLNRGTVATCVRWNGESHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHRRRRRRDAAFAETAAQLHADCRQKQTALQLAISEAKKQSMKTLLESLDEDPWGAHTRWGPARGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFDTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTASVRRVALVSTSNAPPSSRS

Summary

Pfam
PF00098   zf-CCHC        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
PDB
1WDU     E-value=6.67678e-10,     Score=157

Ontologies

Topology

Length:
931
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.46028
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00033
outside
1  -  931
 
 

Population Genetic Test Statistics

Pi
22.990987
Theta
18.141642
Tajima's D
0
CLR
110.529918
CSRT
0.373631318434078
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号