SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09254
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 2.977
 

Sequence

CDS
ATGTCGACGTCGGGCTACCTAGTTAATGTGCCGAAACTCAAAGGTTGCGAAAATTACGATGATTGGGCGTTCGCAACAAGTAATTTTTTGCTGCTCGAAGGCATTGACTTGGAGAACCTTTCCGCAGAAATGAGTGAAGCTGAGATGAAAAAAGCCAAAGCCAAACTCGTCATGACTATTGACTCTTCATTATACGCGCATATCAAGAGTGAGACTACAGTAATCGGTGTATGGAATAAATTGAAACAATTGTTCGATGACACCGGGTATCAACGAAAAATCAGTTTGCTTCGAACGTTAATTTCAGTTCGCCTCGAAAACTGTGATTCGATGACAAGCTACGTATCTCAAATAGTTGAAACTGCGCAGAAATTGAAGGGCACAGGATTCGAAATCACAGATGAGTGGATTGGGTCATTACTTTTGGCGGGACTCTCAGATAAGTTTTCACCTATGATAATGGCGATCGAGCATTCAGGAATCGCCATTAGCGCTGACGTCATTAAGACAAAATTGCTCGATATGTGTGAGGAGGTGGGTACTACTGAAAAAGATTCTGCATTTTGGTCAAAACAACAGCGGTGGAAAAGTGGAAACACTAACCGTGGTGTGAAATCGCAAACGTCAACGTCAAATAGTGACAGAAATGACAGTGCAAGTTCAAATGGCGGTAAACAAATAAAATGTTATAATTGCAAGAAAATAGGGCATTTTAAAAATAAATGTCCCGAACTAAAAACAAAGAAAACCTTAAATGCTTTTAGTGCTGCATTTTTTAACGGAAATTTTAGTACAAAAGACTGGTACGTCGATTCAGGTGCAAGTGCACACATGACGGCAAGTCGAGATTGTTTACAGTTAAATAGACCCGTGCATGAAAACAAAGAAATAGTAGTTGCAAATCAAATGACTGTGCCTGTTGTGAGTGTTGGTGAAACACAGATAACCACGATTGTAAATGGTTCTCAGTATGATGTCATTGTAAAGAATGTTTTATACATACCGAAGCTCACGACAAACTTATTATCGGTAAGTCAACTGATAGCAAATGGCAACAAAGTGTCATTTAAGAAGGATGTTTGTTTAATATATAATCCAGTAAATGAGCTTATAGGAATTGCAAACTTAACTAATGGTGTGTACAAACTACAAATACAAAGACCAGAGAGTGCATTATTGGCCATGACAATGTGGCATAGAAGACTAGGACATGTAAACAGTAAATCTTTAGAAATGATGAAAGAAGGTGCTGTGAAAGGGGTTACTTTTGATAAGAAAGCTGATATTCAGATCAAGAACTGTGAAGTGTGCTGTGAGGGCAAACAGGCTCGTTTCCCTTTCCCATCTGCTAATCATAGAAGTGATATACTACTAGAAGTAATACACTCAGATTTATGTGGGCCGATGGAGACCAAATCAATTGGTCAAGCAAAGTACTTTCTTCTGTTCATAGATGATGCCAGCAGAATGACTTATGTCTATTTCTTGAAGGAAAAGAACCAAGTATTCCAGCATTTCGATAACGGAGGTGAGTTTTGTTCACAAGAGATGGAACACTTCTTAAAACAAACTGGAATCATCCATCAGAAGACTAATCCTCACACTCCACAACAGAATGGACTCTCAGAAAGGTTCAACAGAACTGTAGTTGAACGGGCTAGATGTTTACTGTTTGAATCAGATCTCGACAAAAGTTTTTGGGGTGAAGCAGTAAATACTGCAGTATACCTAATGAATAGAATGCCAGCTGTCAGTCTAGGCATGATGACACCATATGAGAAGTGGACAGGCAAGAAGCCAGATTTGAGCTATGTCAGGATTTTTGGAAGTAAAGTAATGGTGCATGTTCCCAAAGTACAAAGACAAAAATGGGATAAGAAGGCTGACAAATTAATTCTAGTTGGTTATCCGGATAACGTGAAAGGTTACAGACTATATAACCCCAAAACCAGGAAGATTACTACGAGCAGGGACGTCATTATAATAGAGAAAGAACACTCGGACACAGCTCAGGTAGTAGTAAATAATGAAAAAGTGTTGGAGAAAGTTGAAAATTCAGAGAAAGAGAGAAGCATATCAGAAAATTCAACTATAGACGCTAACGATCCTACATATATTTATGACTCATCAAGCTCCCACGAAGATTCATATCAATCGGTGTATGAAAGTGAAAATGAGTCAACCTTAGATTCCATTTTAGAAGAAAATATTCAAAACTTACAGGAGCTTGGTAAGCGCAAGAGAAAGCCAGTAGAAAGATATGGCTATTCCAATCTCTGCATTGTAGATGAGCTGAAATCCTGTGTGATTCGAAAATTGAATTTGAGGCAGCGTTTATTTATTGCTAAAGACAGGGCACTTTTTAATGGTATATTTGCTTTGTTCATACTGATTCATAAAATGAATTTGAGACAGCGTTTATTTATTGCTAGAGACAGAGCAATGTGA
Protein
MSTSGYLVNVPKLKGCENYDDWAFATSNFLLLEGIDLENLSAEMSEAEMKKAKAKLVMTIDSSLYAHIKSETTVIGVWNKLKQLFDDTGYQRKISLLRTLISVRLENCDSMTSYVSQIVETAQKLKGTGFEITDEWIGSLLLAGLSDKFSPMIMAIEHSGIAISADVIKTKLLDMCEEVGTTEKDSAFWSKQQRWKSGNTNRGVKSQTSTSNSDRNDSASSNGGKQIKCYNCKKIGHFKNKCPELKTKKTLNAFSAAFFNGNFSTKDWYVDSGASAHMTASRDCLQLNRPVHENKEIVVANQMTVPVVSVGETQITTIVNGSQYDVIVKNVLYIPKLTTNLLSVSQLIANGNKVSFKKDVCLIYNPVNELIGIANLTNGVYKLQIQRPESALLAMTMWHRRLGHVNSKSLEMMKEGAVKGVTFDKKADIQIKNCEVCCEGKQARFPFPSANHRSDILLEVIHSDLCGPMETKSIGQAKYFLLFIDDASRMTYVYFLKEKNQVFQHFDNGGEFCSQEMEHFLKQTGIIHQKTNPHTPQQNGLSERFNRTVVERARCLLFESDLDKSFWGEAVNTAVYLMNRMPAVSLGMMTPYEKWTGKKPDLSYVRIFGSKVMVHVPKVQRQKWDKKADKLILVGYPDNVKGYRLYNPKTRKITTSRDVIIIEKEHSDTAQVVVNNEKVLEKVENSEKERSISENSTIDANDPTYIYDSSSSHEDSYQSVYESENESTLDSILEENIQNLQELGKRKRKPVERYGYSNLCIVDELKSCVIRKLNLRQRLFIAKDRALFNGIFALFILIHKMNLRQRLFIARDRAM

Summary

EMBL
AGBW02009826    OWR49812.1    GEZM01011856    JAV93393.1    GEZM01011857    JAV93390.1    + More
GEZM01011858    GEZM01011854    JAV93389.1    GALX01001351    JAB67115.1    KQ460297    KPJ16236.1    LBMM01004924    KMQ91985.1    NWSH01002292    PCG68657.1    PCG68658.1    NWSH01000816    PCG74073.1    JXUM01099713    KQ564513    KXJ72145.1    GEHC01000991    JAV46654.1    GEHC01000990    JAV46655.1    GEZM01045162    JAV77889.1    GBHO01003630    JAG39974.1    GANO01000510    JAB59361.1    KQ459875    KPJ19636.1    GFTR01008662    JAW07764.1    GEHC01000989    JAV46656.1    GEHC01000988    JAV46657.1    GBHO01020706    JAG22898.1    GBHO01033237    JAG10367.1    GBHO01026221    JAG17383.1    GBHO01033235    JAG10369.1    GANO01000659    JAB59212.1    GEHC01000867    JAV46778.1    GANO01000660    JAB59211.1    GEHC01000868    JAV46777.1    GBXI01011094    JAD03198.1    KL367628    KFD61291.1    LBMM01017716    KMQ83988.1    GEDC01002834    JAS34464.1    KL367553    KFD64618.1    GAKP01015352    JAC43600.1    GBHO01036544    JAG07060.1    JYDT01000069    KRY86576.1    JYDR01000001    KRY80095.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDH01000330    KRY26802.1    KQ460882    KPJ11482.1    JYDJ01000808    KRX33413.1    JYDJ01000136    KRX42725.1    GDHC01012180    JAQ06449.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    NEVH01019375    PNF22597.1    NEVH01002725    PNF41351.1    NEVH01006721    PNF37230.1    NEVH01006980    PNF36330.1    LVZM01023578    OUC39908.1    JYDK01000071    KRX78146.1    KRX78123.1    LBMM01008124    KMQ89126.1    JYDL01000068    KRX18751.1    GAMC01020352    JAB86203.1    KQ460208    KPJ16606.1    GAMC01018156    JAB88399.1    GFTR01008771    JAW07655.1    GAMC01018157    JAB88398.1    GAMC01018154    JAB88401.1    JYDO01000104    KRZ71003.1    GDHF01030254    JAI22060.1    GAMC01019997    JAB86558.1    GDHF01029191    JAI23123.1    GEZM01013472    GEZM01013471    GEZM01013470    JAV92539.1    GBXI01002679    JAD11613.1    GAMC01011443    JAB95112.1    GAMC01019995    JAB86560.1    QGNW01001128    RVW54433.1    CM003608    KYP66219.1    JYDL01000297    KRX12674.1    JYDN01000113    KRX56900.1    GAMC01019998    JAB86557.1    CM007900    OTG08534.1    JXUM01155348    KQ572178    KXJ68066.1    QGNW01000024    RVX13462.1    CM007899    OTG12557.1    GAMC01020355    JAB86200.1    KYP66486.1    LBMM01008884    KMQ88558.1    LBMM01009686    KMQ87943.1    KL367527    KFD66146.1    JYDM01000185    KRZ84108.1    NWVJ01000098    PCG17690.1    AM466849    CAN77122.1    KL367637    KFD61067.1    QGNW01000748    RVW63137.1    GDHF01027648    JAI24666.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00098   zf-CCHC
PF00665   rve
PF07727   RVT_2
PF13961   DUF4219
PF14244   Retrotran_gag_3
PF05380   Peptidase_A17
PF00078   RVT_1
PF05585   DUF1758
Interpro
IPR025724   GAG-pre-integrase_dom        + More
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR025314   DUF4219       
IPR029472   Copia-like_N       
IPR008042   Retrotrans_Pao       
IPR000477   RT_dom       
IPR008737   Peptidase_asp_put       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
1C6V     E-value=0.0067259,     Score=96

Ontologies

Topology

Length:
815
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
15.46162
Exp number, first 60 AAs:
0.00053
Total prob of N-in:
0.00030
outside
1  -  785
TMhelix
786  -  803
inside
804  -  815
 
 

Population Genetic Test Statistics

Pi
222.552096
Theta
152.327638
Tajima's D
1.357926
CLR
0.336611
CSRT
0.751312434378281
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号