SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09239
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2       + More
Retrovirus-related Pol polyprotein from type-2 retrotransposable element R2DM      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R2
Retrovirus-related Pol polyprotein from type II retrotransposable element R2DM
Location in the cell
Mitochondrial   Reliability : 2.117
 

Sequence

CDS
ATGGCACGAGGCGAAATACCCGAAGTTCTACGGCAGTGCCGAACCGTCTTTGTGCCTAAGGTGGAAAGACCAGGTGGACCGGAGGAATATCGACCGATCTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGACGCACGACAGCGTGGATTTATCTGCGCCGACGGTACTCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTCGACACTGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGTACAGTTCTGCGGCTACATTGCTCACCTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTGAAAGCGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCGATACTCTTCAACGTGGTGATGGACCTCATCCTGGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTCGTGTCCGCTCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGCTGTGGACTGTGTCGGTAGGCAGATGGGCCTACGCCTGAATTGCAGGAAAAGCGCAGTTCTGTCTATGATACCAGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGCAGGTGAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCGTGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGGTTCCAGCACGGTTTCGTGCTTGGAAACATCTCGGATGACAGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTTAGGCTACCGGCGGATGTGCCCAAGGCATACTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTACGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCCGGGGGCTCGACTCGTCACCATGGTCAGTGGCAAGAGCCGCCGCCAAATCTGATAAGATTCGTTGGTAA
Protein
MARGEIPEVLRQCRTVFVPKVERPGGPEEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPVQFCGYIAHLYDTASTTLAVNNEMSSPVKAGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQESISAVDCVGRQMGLRLNCRKSAVLSMIPDGHRKKHHYLTERTFNIGGKPLRQVSCVERWRYLGVDFEASGCVTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFVLGNISDDRLRMLDVQIRKAVGQWLRLPADVPKAYYHAAVQDGGLAIPSVRATIPDLIVRRFRGLDSSPWSVARAAAKSDKIRW

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger   Aspartyl protease   Protease  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2
EMBL
M16558    AAB59214.1    AF436853    AAQ04479.1    AB076841    BAC01114.1    + More
GBBI01004849    JAC13863.1    LBMM01007077    KMQ90064.1    LBMM01006940    KMQ90176.1    GBYB01008309    JAG78076.1    UFQS01003262    UFQT01003262    SSX15424.1    SSX34793.1    L00950    AAZX01002322    GGMS01004512    MBY73715.1    GACK01007407    JAA57627.1    GBBI01004905    JAC13807.1    GBBI01004906    JAC13806.1    GFWV01002964    MAA27694.1    KQ971997    KYB24671.1    GEDV01005279    JAP83278.1    AAZX01010802    AAZX01015897    GFJQ02001120    JAW05850.1    ABJB010902163    ABJB010964728    DS898493    EEC16041.1    GFWV01012635    MAA37364.1    FJ461304    ACJ71597.1    GFWV01007503    MAA32233.1    AAZX01024756    AAZX01024918    JQ082370    AFM44926.1    GFAC01005869    JAT93319.1    X51967    GFAC01005513    JAT93675.1    AB097121    BAC82589.1    GFTR01008394    JAW08032.1    KJ958674    AIL01110.1    GBHO01045037    GBHO01045036    JAF98566.1    JAF98567.1    GBRD01016678    JAG49149.1    AB097122    BAC82590.1    AF015815    AAC34903.1    GDHC01017848    JAQ00781.1    GEDV01003881    JAP84676.1    AAZX01023288    GFAC01000014    JAT99174.1    AAZX01023287    ABLF02008889    KF925878    AHN53448.1    GFWV01001114    MAA25844.1    KZ442244    PIS78050.1    AAZX01010801    AAZX01015898    KK855758    PTY23787.1    EU854578    ACJ46647.1    AF015685    AAB94032.1    UZAN01004728    VDP32110.1    JN937617    AFO19996.1    JN937619    AFO19998.1    KK855289    PTY21830.1    GBHO01018958    JAG24646.1    GFJQ02003336    JAW03634.1    GBRD01002048    JAG63773.1    L00951    NCKV01002648    RWS26564.1    LBMM01009160    KMQ88340.1    NCKV01006447    RWS23444.1    AF015819    AAC34906.1    UYRU01007376    VDK41074.1    ABLF02003433    UYSU01033097    VDL91436.1    UZAL01048126    VDP85427.1    UZAI01021487    VDP55649.1    NCKV01004782    RWS24512.1    LBMM01006509    KMQ90547.1    GFAC01003453    JAT95735.1    AAZX01010936    PTY23786.1    NCKV01009665    RWS22147.1    JN937618    AFO19997.1    NIRI01002286    RJW62659.1    UYSU01042415    VDM03756.1    AB097123    BAC82591.1    NIRI01000035    RJW73594.1    BN000800    CAJ00246.1    NIRI01000312    RJW71711.1    NIRI01001153    RJW67600.1    GFJQ02004269    JAW02701.1    NIRI01000032    RJW73696.1    AHAT01039632    JN937616    AFO19995.1    KZ442293    PIS78045.1    KL596651    KER31070.1    UZAI01007624    VDO99720.1    KZ443466    PIS77927.1    KL367913    KFD59471.1    UYRU01077406    VDN28088.1    GEEE01016792    JAP46433.1    GEEE01017779    JAP45446.1    LBMM01011712    KMQ86679.1    LC155026    BAX24488.1   
Pfam
PF00078   RVT_1        + More
PF00096   zf-C2H2
PF08492   SRP72
PF17004   SRP_TPR_like
PF00850   Hist_deacetyl
PF08356   EF_assoc_2
PF08355   EF_assoc_1
PF00071   Ras
PF13202   EF-hand_5
Interpro
IPR013087   Znf_C2H2_type        + More
IPR000477   RT_dom       
IPR001005   SANT/Myb       
IPR013699   Signal_recog_part_SRP72_RNA-bd       
IPR031545   SRP_TPR-like       
IPR026270   SRP72       
IPR011990   TPR-like_helical_dom_sf       
IPR037138   His_deacetylse_dom_sf       
IPR023696   Ureohydrolase_dom_sf       
IPR000286   His_deacetylse       
IPR023801   His_deacetylse_dom       
IPR036236   Znf_C2H2_sf       
IPR013567   EF_hand_assoc_2       
IPR018247   EF_Hand_1_Ca_BS       
IPR020860   MIRO_dom       
IPR013566   EF_hand_assoc_1       
IPR027417   P-loop_NTPase       
IPR001806   Small_GTPase       
IPR011992   EF-hand-dom_pair       
IPR002048   EF_hand_dom       
SUPFAM
SSF48452   SSF48452        + More
SSF52768   SSF52768       
SSF57667   SSF57667       
SSF52540   SSF52540       
SSF47473   SSF47473       
Gene 3D

Ontologies

Topology

Length:
405
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01081
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00340
outside
1  -  405
 
 

Population Genetic Test Statistics

Pi
47.666044
Theta
121.735707
Tajima's D
-1.344784
CLR
0
CSRT
0.0831958402079896
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号