SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09225  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA003411
Annotation
hypothetical_protein_KGM_21558_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 2.75
 

Sequence

CDS
ATGGATAGCCACAGCAGATCGGCGTCGCCTCGCGACAGGCCGCAGCAGAGGCCGCCTTCGCCGCCCTCCCCACACGGCTACGACAACAAAGTCTTCCAGCACGACGAATCCGATCCAAACCACAACGACTCCTTCGCGTCCAACGGCGCGCAACAGAACCAACTCAACGGAGACACAAAAACATTAGAGGCCGTCAATTTAGAATTGTTGAATTTAGCACCGAAGAATGGTAATGCGAAAAAGAAGGATGTGGAGATAGATATGAACGGCACGAACCCGTACGATGAATACTTCGTGCCCGTCAACGAACACAGGAAGTTTATGAGGGGTGAAAAGTTGTACGTGACGGCGGACAAACGTGGCGATAAGGGAGGTTGTAAGCGACCTCTTTGCTGGACCCTGTTGGCGCTTGTTGTGGCCGCTATTGTTGCACTAATAGTACTGGCAGCCACCGGAATAGGATTTTCGAATTCTGCACTGGAAAATCATCTCGAACAAAATACATCGATTAGTTCAGCGCGAGCTCTGGGCGGCCTCACCATACCTATAGCGGCAGAAGAGACAAACGACACTGAATTACACGATAATAACGTGATGAATGAGGAGCCGTCTAGTGATGCAGAACCAACACCAGAGCCAGAACCGGCAATCAACGACGTACAGTCAAGAGACGCAGTACCGACCCCAGAGCCAGAGCCCCAGCCAGATACATCAATAAACCAGGAACCGTCTAGAGAAGCAGTGCCAACACCAGAGCCGGAACCATCAATAAGTGAGGAACCGTCTAGGGAAGCAATGCCAACACCAGAACCAGAGCCAGTAATAAGCCAGGAGGCGTCTAGAGAAGCAGTACCAACACCAGAGCCGGAACCATCAATAAGCGAGGAACCATCTAGGGAAGCAATGCCAACACCAGAACCGGAGCCATCAATAAGCCAGGAACCATCCAGAGAATCAATGCCCACACCGGAGCCGGAGCCACCAATAAGCCAGGGACCATCCAAAGAAGCAGTACCATCATCAGAACCAGAGACACCAATAAACCATGAACCATCCAGGGAATCAATGCCAACACCAGAGCCAGAACCAGCGATAAACCAGGAGGCGTCTACAGAAGCAGTACCAACACCAGAGCCGAACCCATCAATAAACCAGGGGTCATATAGTAATGCAGAACCAACACCAGAGCCAGAACCGGCAATAAACGAAGTAGCATCCAAAGATGCAGTCACAACACCAGAGCCCGAGCCATCAATAAACCAGGAACAATCTATAAAAATGACACCGACAGTAGAGCAAGACTTATTAATTCATCAGGAACCATTTAAAGAGGCGGTGCAAACAACTGAACAACAACCATCAATAAACGAGGAAGAAACAACAGAGCCACATTTCCCAATTAACCAAGAACCATCTAGAGACATTACACTAACGATCGAGCCAGAATCATCAGCAAACCATGAAACATCTAAGGACGTAGAATCTGTAAACAAGGGAGAATCTAGTGAAACAACAACAACAGTATTTGAACCTACAATAAACCATGAATCATCTAGTGAAATGGTACCGACACTGGAGCCAAAAACATCAATAAACGAAGTGCGATCTGAACAAACAGTGCCGGATCCAGAAACATCATTAAACAAAATATCTTCAAATGAAATGGTGCCTACAACAGTGACACAATTAGAATTAAGCCAGGGACCAACTAGAGACGTAGTGACAACATTAAGGCCGGATATGTCAATGAATGATGAACAGCCTATAGAAATTGCACAAAAAATAGAGCCAGAAACGTCAATAAATCACGAATTATCTAGAGGAATGCCACACATAATAGAGTCAGAACCGACAATAGATCTAGAGTCAATCATAGAGCCAGAGCCGACGATAGAGCCAGAACCGACAATAGAGACAGAGCCAACGATAGAAACAGAGCCGACAATAGAAACAGAGTCGACGATAGACAAAGAACCATCAATAAACCAGGTGCTATTGAGTGAAATGACTCCAACATCGGACCCAGAAACAGTAAAAGAGAGAGAAATGACACCGGTAATAAGCCCAGAACTGACAATAAACCAAGAAAAATCTAGAGAAATGATATCGACTATAGAGCCAGAGCGATCAATAAACTTTGAAAAGACAACAGAGTTCCAACTATCAACAAATGAGAAAGAATCCCGTGAAATGACACCAACATTAACACCTCAATTAAACAATGAAGATGTAACAAGAACACAATCGATGGAAAATCAAGAACAACCTGGGGAAGCCGAACCAGTAATAGACCTAAAAACATCTATAACTCACGAATTAGATACAAAAACGATTTCAACAACCGAGCCCCAATTATCAACAGACCGCGAAGAACACGTAGAACCACCATCATCAACAAATCAAGAACGTTCTAGAGAAATGGCACCAGAAACAGCACAGCGATCAGTTAAGGTGGTAGAAGTAACCAAAGTTCAGTCACCAATAAACCAGGAACAATTTAGAGAACCCGCACAAACAATAGAGCCCGAACCGCCAACAAACGCTGAAGAAACAACAGAGCAACTACTATCAGTGAACCAGGAACCGTTTGGAGAAACGATCCCGACCATAGAACCAGAACCAATTGATAATGAAGAAACTACAGAACAACCATCGTCGATAAATCACGCATCCAAAGATATTGTATTAACATCTGAAGCAGAACTAGCAAACCAAGAACGATCGAGAGAACAACCGAACTTTTCCATTGACCAGAAAAACACAACTGAACTAGAATCACCGATTAATCAAACAGAAACAACAGAACCACAATTTTCAGTAAGCAAACAGCCATCTGGAGAAATTTCAGCAATACCAGAGTCAGTTTCATCCGTAAATCAGGAACATACAACAGAACCTCAATCATCAATGGATCAAGAACCATCTAACGAAATTTCAGCAACAACAAAGTCACAATCATCAATAGACCAAGAAGAAACAACTGAGCAACAAATATCAGCAAACCAGGAAGAGATAAATGACGAAGATTTCTTAGTGAATTCTGATGAAGAAAATAGCCCAGGCTCGTCGGCAAACGAAGTAGAAACAATAGAAACGGATTCCTCATTAAATGAGCAAAAAGTTAAAGAAACAACAACAGAATCTCAGTCATCATACAAACAAGACCTATCTACAGAAACGTCATCAACAACAGAGCTACAACCATCAGAACAAAAGGAAGAAACAGATGATCAACACTCATCAACAAACCAAGTTGAAACAACAGAACTAGAAACATCAGTAAATCAAGAACAAGAACCAGACCTGGCATTGACTGTGGAACCGCTGCCATCTGAAATCCAAGAAGAAACTACAGAGTCACATTCGTCAGCAAACCAGGAAACATCCAAAGAAATATCTTCAACAACAGAATCACAATCTATTGTGAGCCAAGAACCATCTGTAGATGTGTCTTTAACCGTGGGGCCACTGACAACCACAATCCGAGAAGAATCAACAGAAGAACCTAAAATATCTAAGGAGGTATCACTGAGAAACAATACGGACAATAATGTAGAGCTAACGGCAGAAAAACCAAGCGAAAACGAACGATCGAGTAAAATACCACAAATACAAATTTACGAAGTGAGGCCCACAGACTTACCTGAAATTTTCTCGCCGGCAACAATGCACCCGCCAATAAAGTCGCCCAGCTTTTCAAACGATCGCGAACCTACATCAACAGGACTACCATTTTTGGAAGACATGAATGATATTTATTAG
Protein
MDSHSRSASPRDRPQQRPPSPPSPHGYDNKVFQHDESDPNHNDSFASNGAQQNQLNGDTKTLEAVNLELLNLAPKNGNAKKKDVEIDMNGTNPYDEYFVPVNEHRKFMRGEKLYVTADKRGDKGGCKRPLCWTLLALVVAAIVALIVLAATGIGFSNSALENHLEQNTSISSARALGGLTIPIAAEETNDTELHDNNVMNEEPSSDAEPTPEPEPAINDVQSRDAVPTPEPEPQPDTSINQEPSREAVPTPEPEPSISEEPSREAMPTPEPEPVISQEASREAVPTPEPEPSISEEPSREAMPTPEPEPSISQEPSRESMPTPEPEPPISQGPSKEAVPSSEPETPINHEPSRESMPTPEPEPAINQEASTEAVPTPEPNPSINQGSYSNAEPTPEPEPAINEVASKDAVTTPEPEPSINQEQSIKMTPTVEQDLLIHQEPFKEAVQTTEQQPSINEEETTEPHFPINQEPSRDITLTIEPESSANHETSKDVESVNKGESSETTTTVFEPTINHESSSEMVPTLEPKTSINEVRSEQTVPDPETSLNKISSNEMVPTTVTQLELSQGPTRDVVTTLRPDMSMNDEQPIEIAQKIEPETSINHELSRGMPHIIESEPTIDLESIIEPEPTIEPEPTIETEPTIETEPTIETESTIDKEPSINQVLLSEMTPTSDPETVKEREMTPVISPELTINQEKSREMISTIEPERSINFEKTTEFQLSTNEKESREMTPTLTPQLNNEDVTRTQSMENQEQPGEAEPVIDLKTSITHELDTKTISTTEPQLSTDREEHVEPPSSTNQERSREMAPETAQRSVKVVEVTKVQSPINQEQFREPAQTIEPEPPTNAEETTEQLLSVNQEPFGETIPTIEPEPIDNEETTEQPSSINHASKDIVLTSEAELANQERSREQPNFSIDQKNTTELESPINQTETTEPQFSVSKQPSGEISAIPESVSSVNQEHTTEPQSSMDQEPSNEISATTKSQSSIDQEETTEQQISANQEEINDEDFLVNSDEENSPGSSANEVETIETDSSLNEQKVKETTTESQSSYKQDLSTETSSTTELQPSEQKEETDDQHSSTNQVETTELETSVNQEQEPDLALTVEPLPSEIQEETTESHSSANQETSKEISSTTESQSIVSQEPSVDVSLTVGPLTTTIREESTEEPKISKEVSLRNNTDNNVELTAEKPSENERSSKIPQIQIYEVRPTDLPEIFSPATMHPPIKSPSFSNDREPTSTGLPFLEDMNDIY

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
1253
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.69531
Exp number, first 60 AAs:
0
Total prob of N-in:
0.99922
inside
1  -  129
TMhelix
130  -  152
outside
153  -  1253
 
 

Population Genetic Test Statistics

Pi
245.927031
Theta
182.407806
Tajima's D
0.695723
CLR
0.924752
CSRT
0.569571521423929
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号