SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09196
Pre Gene Modal
BGIBMGA003354
Annotation
PREDICTED:_uncharacterized_protein_LOC106720810_[Papilio_machaon]
Full name
ATP-dependent DNA helicase      
Location in the cell
Nuclear   Reliability : 3.272
 

Sequence

CDS
ATGGTTTTTGGTCAGGCCCTAGATGCTGAACGCCACGCATCTCAAAGAGCCTCTGAGACGTTTACGCAGACTGAGACCCGTCAGGCCCTGGATGCTGAACGCCACGCATCTCAAAGGGCCTCTGAGACCTATACGCAGACTCAAGCCCGACAAACCTTAGATGCTGAGCGCCACGCATTTCAAAGGGCCTCTGAGACGTTTACGCAGACTCAGGCCCGTCAGACCCTGGATGCTGAACGCCACGCATCTCAAAGAGCTGCTGAGACAGTGGAACAGACTCAGACACGTCGAGTTTTAGATGCCGAACGTCACGCGCAATTGATTGCGGCAGAGACTGACGAAGATTCACAAAGACGACGTCTTTTAAATGCTGAACGGCAGGCAGAAAGAAGACGTACGTTTTCAATGAGTACGTGGGAGGCATTTAATGGTGCCGCTTTTGAGTATGACCCTTTGATCGACTATGTTAATCACCGATTGGTTATCATTGGGAGAATGGATAAAAAATGCAGATATTGTGAAGCACTGAAATGGAAAGAAGAAACTCCAGGTATGTGCTGTTCTGGTGGAAAGGTTAAAATTCCATTACTTGGCGAGCCAGAGGAACCTCTTAAATCTTTACTTTTATACGACAGTAACGAATCGCGCCGGTTTTTAAGCAGGATTAGAAAGTATAATTCTTGCTTTCAGATGACGTCATTTGGTGTAGATAAGGAGGTCGTAATGCCTGGATTTTCACCTACTTTTACCGTCCAAGGACAGGTGTATCACAGGATTGGTTCCTTACTTCCCGCAAATAATGAACAACCAAAGTTTTTGCAACTTTATTTCATGGGCGATGAAAAAAACGAAGCTGATCGCAGGTGTCAAAATATACAAGGAATCGAAAGGGATACTGTTTTAAAAATCCAGAGAATGTTGCATGAACATAATCGCCTTATCAATACTTTCAAAACAGCACTAGAAAGAATGCCGGGAGAGGATTATAGGTTGGTGATGCACCCCGATCGCACACCAAGTGGGGAACATGAAAGGCGGTATAATGCACCGTTAATAAATGAAGTCGCAGCCTTGGTTACAGGCGAACAGTTTGCTTTCCGTGATATAGTTTTACAGGCCCGAGATGACACATTAACCAGGGTGCCTGATACTCATAAATTTTATGATGCGTTGCAATATCCGATCATATTTAGTAAGGGACAAGAGGGGTACCACTTTCAAGTTCCTCAAATTAATCCTGTAACAGGTCTTCCCTTGCATAACAAAAAGGTTTCATGCATGGATTTTTATGCCTACAACATGATGATACGAGAAAACAACTTTAACATTGTACAAAGATGCAAGCAACTGGCCAATCAGTTTTACGTTGACATGTACGTTAAAGTTGAAAGCGAGAGGTTACGGTACATATCATTAAATCAAACTAAACTAAGAGCAGAGAATTACATCCATCTTCAAGACGCTGTGGCAAATGACGCTAATTTAAATCCAAATAACTTAGGTCGTATGGTCATTTTACCATCTTCATTTGTAAATAGCCCGCGGTACTTACACGAATATACTCAGGACGCGTTTGTTTATGTGCGTACACATGGTCGCCCTGACTTATTCGTCACCTTTACTTGCAAACCAGCCTGGCCCGAAATAGTCAATCAGTTGATGCCGGGGCAAAGCGCAATAGATAGACATGATGTAGTCGCAAGAGTTTTTAGACTAAAAGTTAAAAAACTAATGGATGTGATTAATAAAGGCCGAGTGTTCAGAGAAGCGCGCTGCTTTATGTACTCTGTCGAATGGCAGAAACGTGGACTGCCACATGTCCATATATTATTGTGGTTAAAAGATAAGTTACGACCCGATCAAATAGATAACATAATCAGCGCTGAAATACCGGATCCTAACATTGACAAGACTCTCCATGACATTATTGTAAAAAATATGATTCACGGTCCATGCGGACCCGAAAATCCACAGTGCCACTGCATGAAAGACGGAAAATGCACAAAAAAATTTCCTCGCAAGTTAGTGAAAGAGACCGTTCACAACAACCACGGATACCCGCAGTATCGTAGAAGAGCGCCAGCAGACGGAGGTCGAACAGCAACCGTGAAGCTCCGAAATGGTAGCTACGTTACGGTTGATAATAGTTGGGTAGTCCCCTATTCACCAATTTTATCAAAAATGTTTAACGCCCACATAAATGTTGAGGCATGCAGTTCAGTACGCGCCATCAAATATATTTGCAAATATATAAACAAGGGTAGTGATCAAGCTATTTTCAATTTTAGAAATACTGATCTTGCGAATCCCGTAGATGAGGTACAAACTTATCAGTCTGGTCGGTATGTCAGCAGCAACGAAGCCGTGTGGCGTCTGTTAGCATTTCCGTTGCACGAAAGGCATCCCACCGTGACACATCTCAGCGTGCATTTAGAAAATGGTGAACGCGTTTATTTTAATGAACACAATTTCCACGAACGAATAACTACTCCGCCAAAAACCACACTCACTGCTTTTTTTGATCTTTGTATCAGAGATGAGTTTGCAAAAACTCTTCTTTATGTCGAGGTGCCGAGGTATTATACTTGGGATGCAAGTAGGAAAACTTGGAAAAGCCGCATTCAAGGTACTTCAGTTCACGATTGGCCTGGCGTCAAATCTGGAGATGCTTTAGGACGAGTTTATACAGTTCATGTTAGTAACATGGAATGTTTTTGTCTACGCATGCTTTTACACCATGTGCGCGGACCTACCTCTTTCAATGATCTAAAAAAATACAACACACAAGATTATCCTACATTTCGAGAGGCATGTGAGGCAAGAGGATTACTGGAGAATGACAACCATTGGGATGTGACACTGGAAGAAGCTGCTCAATGTAGATCAGCAGGCAAGATGAGAGAGCTATTTGCTGTATTAGTAGCGACATGTGGTCTTTCAAATCCTCAACAATTGTGGGATAAATACAAAAATGATATGACCGACGATATATTGCACAGATTACAAGAGCAAAATCCCAATGTCACGTACAGTGATTTAATTTACAATGAGGGTCTGACAAAAATTGAAGACCAGGTTAAAACAATTTCTAGAAAGGATTTATCAGATTATGGAATGATCAGACCACAGAGAACCGAGGAAATCAGTAGCGATTTAATACGGGAACTAGATTACGATACTGCTTCCTTACAACAACAATTGACAGAGTCTGTTCCACGTTTGATCCCAGAACAAAGTCTGTCTACAAATATGAGAGTGCAACTACACAATGATGTACAATCTGGACAATATGCTGCTGCTCTTCTTAAAATTGGAGAAGATCGTATGGCAAAGGATGGTAATGGCATGATTACATTGGATCGTGAATTCTGCAATGTTGTGCATAATCCAGATGATCTAAATAACTTCGTCTATAGCGAACTGCTAACTAATATGAGGAATAGAGACTGGTTATGTGAAAGAGCAATTTTAGCGCCGACGAATGAAATGGTGGGACAGATAAACGAGCAAATTATGTCACGCGTGGAAGGTGATATTGTTGAGTTTCTCTCTGTAGACACTGTAATGGATACTGAACAAGAAACATTCGGAGCTATCCATTATGTAGCTTAG
Protein
MVFGQALDAERHASQRASETFTQTETRQALDAERHASQRASETYTQTQARQTLDAERHAFQRASETFTQTQARQTLDAERHASQRAAETVEQTQTRRVLDAERHAQLIAAETDEDSQRRRLLNAERQAERRRTFSMSTWEAFNGAAFEYDPLIDYVNHRLVIIGRMDKKCRYCEALKWKEETPGMCCSGGKVKIPLLGEPEEPLKSLLLYDSNESRRFLSRIRKYNSCFQMTSFGVDKEVVMPGFSPTFTVQGQVYHRIGSLLPANNEQPKFLQLYFMGDEKNEADRRCQNIQGIERDTVLKIQRMLHEHNRLINTFKTALERMPGEDYRLVMHPDRTPSGEHERRYNAPLINEVAALVTGEQFAFRDIVLQARDDTLTRVPDTHKFYDALQYPIIFSKGQEGYHFQVPQINPVTGLPLHNKKVSCMDFYAYNMMIRENNFNIVQRCKQLANQFYVDMYVKVESERLRYISLNQTKLRAENYIHLQDAVANDANLNPNNLGRMVILPSSFVNSPRYLHEYTQDAFVYVRTHGRPDLFVTFTCKPAWPEIVNQLMPGQSAIDRHDVVARVFRLKVKKLMDVINKGRVFREARCFMYSVEWQKRGLPHVHILLWLKDKLRPDQIDNIISAEIPDPNIDKTLHDIIVKNMIHGPCGPENPQCHCMKDGKCTKKFPRKLVKETVHNNHGYPQYRRRAPADGGRTATVKLRNGSYVTVDNSWVVPYSPILSKMFNAHINVEACSSVRAIKYICKYINKGSDQAIFNFRNTDLANPVDEVQTYQSGRYVSSNEAVWRLLAFPLHERHPTVTHLSVHLENGERVYFNEHNFHERITTPPKTTLTAFFDLCIRDEFAKTLLYVEVPRYYTWDASRKTWKSRIQGTSVHDWPGVKSGDALGRVYTVHVSNMECFCLRMLLHHVRGPTSFNDLKKYNTQDYPTFREACEARGLLENDNHWDVTLEEAAQCRSAGKMRELFAVLVATCGLSNPQQLWDKYKNDMTDDILHRLQEQNPNVTYSDLIYNEGLTKIEDQVKTISRKDLSDYGMIRPQRTEEISSDLIRELDYDTASLQQQLTESVPRLIPEQSLSTNMRVQLHNDVQSGQYAAALLKIGEDRMAKDGNGMITLDREFCNVVHNPDDLNNFVYSELLTNMRNRDWLCERAILAPTNEMVGQINEQIMSRVEGDIVEFLSVDTVMDTEQETFGAIHYVA

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
EMBL
NIVC01000366    PAA84583.1    NIVC01000229    PAA87485.1    NIVC01000900    PAA75136.1    + More
NIVC01001445    PAA67902.1    KE126587    EPB66060.1    NIVC01000111    PAA90396.1    NIVC01001486    PAA67379.1    JARK01000714    EYC35207.1    NIVC01001359    PAA68995.1    KN743176    KIH52626.1    HQ009558    AEE09607.1    RSAL01000011    RVE53580.1    JOJR01000041    RCN48933.1    GL444143    EFN61253.1    RSAL01001639    RVE40746.1    ABLF02041819    JOJR01000205    RCN42227.1    ABLF02018127    LBMM01013912    KMQ85421.1    NIVC01001383    PAA68602.1    NIVC01004811    PAA46541.1    NIVC01000291    PAA86185.1    NIVC01002034    PAA61410.1    NIVC01000566    PAA80831.1    ABLF02020814    ABLF02049665    NIVC01001945    PAA62370.1    NIVC01000381    PAA84309.1    NIVC01001722    PAA64736.1    NIVC01004666    PAA46875.1    NIVC01000290    PAA86251.1    NIVC01000042    PAA92669.1    NIVC01002028    PAA61494.1    NIVC01002407    PAA58126.1    NIVC01002018    NIVC01001743    NIVC01000051    PAA61561.1    PAA64516.1    PAA92464.1    NIVC01004365    PAA47686.1    BEXD01001738    GBB95559.1    BDIQ01000091    GBC29771.1    BDIQ01000117    GBC37632.1    JEMT01027503    EXX56857.1    BDIQ01000188    GBC51003.1    BDIQ01000010    GBC12419.1    LUEZ02000010    RDB29535.1    PDCK01000043    PRQ29370.1    AWUE01015533    OMO96975.1    CDSF01000088    CEO98944.1    KZ866277    RIA04643.1    KN818726    KIL54493.1    OIVN01004665    SPD18618.1    KN737550    KIH55324.1   
Pfam
PF05970   PIF1        + More
PF14214   Helitron_like_N
PF02689   Herpes_Helicase
Interpro
IPR025476   Helitron_helicase-like        + More
IPR010285   DNA_helicase_pif1-like       
IPR027417   P-loop_NTPase       
IPR038765   Papain-like_cys_pep_sf       
IPR003653   Peptidase_C48_C       
IPR003840   DNA_helicase       
IPR003323   OTU_dom       
SUPFAM
SSF52540   SSF52540        + More
SSF54001   SSF54001       

Ontologies

Topology

Length:
1203
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00046
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1203
 
 

Population Genetic Test Statistics

Pi
219.083062
Theta
167.473053
Tajima's D
1.141967
CLR
175.634458
CSRT
0.701164941752912
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号