SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09187
Pre Gene Modal
BGIBMGA003359
Annotation
PREDICTED:_probable_multidrug_resistance-associated_protein_lethal(2)03659_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.019
 

Sequence

CDS
ATGAGGAAAAATTTGGATCCTTTTGATGAGTATTCGGACGAGGTCTTGATAAATGCACTGAAAAGTGTAGAGTTGCAAGGCGAAGGAGAGAGCGTCGGTGTACTTTACAAAGACGTGTCTGAAGGTGGATCAAACTTCAGTGTGGGAGAACGCCAACTCGTATGTTTAGCGAGAGCCATCGTCCACAACGACCGAATTTTAGTACTGGACGAGGCGACCGCTAATGTCGATGCTCAAACAGACTCCTTGATTCAAAACACCATAAGGGAACACTTCAAAGAATGCACTGTGCTTACCATTGCGCACAGATTGAACACTGTTATAGATTCTAACAAGATTTTGGTGCTAGACGCGGGTCGTCTGGTAGAGTTCGACCATCCTCATATACTTCTGCAAAACAAGAGAGGGCAATTTCGTAAAATGGTGCAGGAAACAGGCCCGTCGATGTCGAATTTACTCCACAAACTAGCCTCTCAGGTACATATCGCGATTTCTACTACAAGTAGTTATTAA
Protein
MRKNLDPFDEYSDEVLINALKSVELQGEGESVGVLYKDVSEGGSNFSVGERQLVCLARAIVHNDRILVLDEATANVDAQTDSLIQNTIREHFKECTVLTIAHRLNTVIDSNKILVLDAGRLVEFDHPHILLQNKRGQFRKMVQETGPSMSNLLHKLASQVHIAISTTSSY

Summary

EMBL
BABH01023741    BABH01023742    BABH01023743    BABH01023744    RSAL01000296    RVE42812.1    + More
ODYU01005653    SOQ46723.1    KQ460615    KPJ13784.1    KQ459602    KPI93524.1    NWSH01001138    PCG72438.1    AGBW02011215    OWR47028.1    ODYU01012282    SOQ58506.1    GGMR01003311    MBY15930.1    GGMR01010715    MBY23334.1    GGMR01018190    MBY30809.1    ABLF02035621    GFXV01002853    MBW14658.1    GGMR01013310    MBY25929.1    GGMS01012319    MBY81522.1    AK403773    BAM19925.1    GGMR01000367    MBY12986.1    GGMR01015946    MBY28565.1    ABLF02042979    GECZ01003398    JAS66371.1    BABH01002489    BABH01002490    GFXV01001174    MBW12979.1    ABLF02014369    GFXV01002383    MBW14188.1    NEVH01025663    PNF15053.1    GGMR01000210    MBY12829.1    PNF15046.1    GGMR01005934    MBY18553.1    GEZM01038206    JAV81719.1    KPJ13630.1    GFXV01005154    MBW16959.1    GGMS01004220    MBY73423.1    ABLF02014368    LJIG01002640    KRT84300.1    GGMR01011553    MBY24172.1    MH172501    QAA95908.1    KT276302    ALS30429.1    GEZM01099515    JAV53285.1    GGMS01018004    MBY87207.1    ODYU01004966    SOQ45370.1    GEZM01059508    JAV71448.1    NWSH01000076    PCG79892.1    GEBQ01005888    JAT34089.1    KK853083    KDR11623.1    GEZM01016939    JAV91033.1    LJIG01022813    KRT78583.1    GEZM01016941    GEZM01016940    GEZM01016938    JAV91034.1    GGMS01012154    MBY81357.1    NEVH01001336    PNF43103.1    GECU01036358    JAS71348.1    KM453743    KP335688    AKC34058.1    AKC34900.1    GGMS01014778    MBY83981.1    GGMS01011917    MBY81120.1    GECU01006806    JAT00901.1    GEZM01091336    JAV56901.1    ABLF02027734    GBYX01473114    JAO08540.1    ABLF02027727    ABLF02027732    AEFK01129726    AEFK01129727    AEFK01129728    AEFK01129729    AEFK01129730    AEFK01129731    AEFK01129732    AEFK01129733    AEFK01129734    AEFK01129735    AFYH01243657    AFYH01243658    AFYH01243659    AFYH01243660    AFYH01243661    AFYH01243662    AFYH01243663    AFYH01243664    GEZM01061568    JAV70366.1    GBBI01002866    JAC15846.1    KPI93378.1    GEZM01099513    JAV53288.1    GEZM01099514    JAV53287.1    ABLF02035628    ABLF02035624    GALX01005041    JAB63425.1    KF828787    AIN44104.1    GBYX01473128    JAO08526.1    GEBQ01012668    JAT27309.1    KF828786    AIN44103.1    PNF43104.1    GGMS01006388    MBY75591.1    CYRY02020558    VCW97093.1    GDKW01000545    JAI56050.1    GDAI01002419    JAI15184.1    AWGT02000258    OXB72712.1    ABLF02014366    GBGD01000127    JAC88762.1    PNF43102.1    GECL01002731    JAP03393.1    KY484779    ASS36021.1    GBYB01005573    JAG75340.1    MF034776    AVT42142.1    AGCU01023494    AGCU01023495    AGCU01023496    AGCU01023497    AGCU01023498    AGCU01023499    ABLF02035626    BDOT01000013    GCF43884.1    PYGN01000371    PSN47509.1    KK107928    EZA47172.1    KB632390    ERL94421.1   
Pfam
PF00005   ABC_tran        + More
PF00664   ABC_membrane
PF16363   GDP_Man_Dehyd
Interpro
IPR017871   ABC_transporter_CS        + More
IPR003593   AAA+_ATPase       
IPR003439   ABC_transporter-like       
IPR036640   ABC1_TM_sf       
IPR027417   P-loop_NTPase       
IPR011527   ABC1_TM_dom       
IPR030240   ABCC4       
IPR000788   RNR_lg_C       
IPR016040   NAD(P)-bd_dom       
IPR036291   NAD(P)-bd_dom_sf       
IPR030244   Yor1       
IPR009147   CFTR/ABCC7       
SUPFAM
SSF52540   SSF52540        + More
SSF90123   SSF90123       
SSF51735   SSF51735       
Gene 3D
PDB
6BHU     E-value=3.50573e-37,     Score=383

Ontologies

Topology

Length:
170
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00081
Exp number, first 60 AAs:
0
Total prob of N-in:
0.10267
outside
1  -  170
 
 

Population Genetic Test Statistics

Pi
231.273851
Theta
181.244397
Tajima's D
0.868506
CLR
0.034426
CSRT
0.619769011549423
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号