SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09156
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Mitochondrial   Reliability : 1.561 PlasmaMembrane   Reliability : 1.283
 

Sequence

CDS
ATGATAAATATAAAATGTCTTTTCCAGGGTTATGGATGTTTTCTCCGCACCCTGATAGAGGACTACCTCTCAGGGCGGAGCGTGATTTTCCCCGAGAGAAGAGGATGGGGACGAAAAACGGTGTCGTGCGGGGTCCCACAGGGGTCGGTATTGGGACCACTCCTGTGGGACATCGGTTTCGACTGGGTCCTCCGCGGTGCTGGCCTGCGTGGCGTCGACGTGGTGTGCTATGCCGACGACACGTTGGTGACGGCTCGCGGAGCTGACTACAGGACCGCAGCGATCCTTGCAACGGCGGCGGTCTCCACCGTCGTTAGCCGCATTCGGAGACTAGGTCTTGAGGTGGCCCTCCACAAGTCTGAGGCCGTATGCTTTCACCCGGTTCGGAGAGGACCCCCTCCGGGCGCGACGCTCATAGTCGGTGGAGTATCGATCGCTGTCCAGCCGAAGCTCAAATATTTGGGCATCGTGCTGGACAGTCGATGGCGCTTCGACCACCATTTTGGTGAGTTGATTCCGAGGCTACTGGGCATGGCAGGTGCGTTAGTCCGTCTTCTGCCCAACGTTGGTGGTTGCAGCGTCGGTGTCCGACGCCTGTACCTGGGGGTCGTGCGCAGTATGGCCTTGTATGGCGCTCCCGTGTGGTCGCCCACACTCTCCGCACGCAATGCGGCGCTGCTGCTCCGAGCTCAGCGGGCGCTCGCGGTGAGGGTCATCAGGGGGTACCGTACGATCTCCCGAGAGGTCGCCTGTGCCCTCGCTGGTTCCCTTCCTTGGGATCTCGAGGCCGAGGTATTGGCTACGGTATACCGGCGCAGGACACAGTCCCTGGGTCGGGGACGGACACCCGGCCTGTCGGCTGTCAGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCTAAATGGAGGGAGCGGTTGCTGGAGGAACTTCATCAAACCTCAGCCACCCGCCGGCGCACTCTCGAGGCCCTGGTGCCCGTGCTGGAGACATGGTCAGATCGGCGACACGGCGTGCTCTCCTTCCGCCTTACGCAGGTCCTCTCGGGGCATGGCTGCTTCGGGAGGTACCTGTGGAGGGTTTGCAGGAGAGAGCCACATCCGGGTTGTCACCAGTGCGGGCATCCGGATGATGACGCTCAGCACGCACTCGAAGCGTGCCCGCGTTGGGAGCACCCGCGGCGAGATCTCATCGCGGTGCTGGGGAGGGACCTCTCCTTGCGGGCTGTCATTGCCCGCATGCTAGAGGACGAGAGTTCGTGGGGGGCCATGGCCAGATTTTGCGACCTGGTCATGGCGTTCCGCGAGGCTGAGGAGCGCGAAAGGGAGTGGAATCCCTCTTCGGCTCCTCAGCGAAGAAGGCGGGGTGGGCGACGCGGGCACGATGCTCCCGTTAATCTCCCGTAG
Protein
MINIKCLFQGYGCFLRTLIEDYLSGRSVIFPERRGWGRKTVSCGVPQGSVLGPLLWDIGFDWVLRGAGLRGVDVVCYADDTLVTARGADYRTAAILATAAVSTVVSRIRRLGLEVALHKSEAVCFHPVRRGPPPGATLIVGGVSIAVQPKLKYLGIVLDSRWRFDHHFGELIPRLLGMAGALVRLLPNVGGCSVGVRRLYLGVVRSMALYGAPVWSPTLSARNAALLLRAQRALAVRVIRGYRTISREVACALAGSLPWDLEAEVLATVYRRRTQSLGRGRTPGLSAVSRWRRAARHLAYAKWRERLLEELHQTSATRRRTLEALVPVLETWSDRRHGVLSFRLTQVLSGHGCFGRYLWRVCRREPHPGCHQCGHPDDDAQHALEACPRWEHPRRDLIAVLGRDLSLRAVIARMLEDESSWGAMARFCDLVMAFREAEEREREWNPSSAPQRRRRGGRRGHDAPVNLP

Summary

EMBL
D85594    BAA19776.1    AB078935    BAC06462.1    AB078930    BAC06454.1    + More
AB078931    BAC06456.1    AB078929    BAC06452.1    KZ150386    PZC71062.1    RSAL01000481    RVE41577.1    AB090825    BAC57926.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    KQ460685    KPJ12887.1    LBMM01019839    KMQ83438.1    LBMM01024063    KMQ82623.1    LBMM01006954    KMQ90166.1    LBMM01019838    KMQ83439.1    LBMM01005733    KMQ91252.1    LBMM01006725    KMQ90373.1    LBMM01002052    KMQ95336.1    LBMM01006671    KMQ90407.1    LBMM01004272    KMQ92618.1    LBMM01003245    KMQ93755.1    LBMM01015018    KMQ84954.1    QOIP01000010    RLU18098.1    LBMM01004505    KMQ92346.1    QOIP01000031    RLU14697.1    LBMM01006657    KMQ90417.1    LBMM01014122    KMQ85315.1    LBMM01002480    KMQ94776.1    LBMM01015025    KMQ84953.1    LBMM01014132    KMQ85305.1    LBMM01004634    KMQ92224.1    LBMM01008682    KMQ88705.1    LBMM01007425    KMQ89740.1    LBMM01007036    KMQ90099.1    LBMM01005216    KMQ91703.1    GFXV01002242    MBW14047.1    LBMM01014956    KMQ84982.1    LBMM01006063    KMQ90967.1    LBMM01008448    KMQ88867.1    LBMM01003988    KMQ92922.1    ABLF02014530    ABLF02018586    ABLF02058000    LBMM01021647    KMQ83033.1    LBMM01005465    KMQ91492.1    LBMM01008422    KMQ88894.1    LBMM01005474    KMQ91485.1    LBMM01012412    KMQ86235.1    GDHF01014602    JAI37712.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GAKP01002292    JAC56660.1    LBMM01008278    KMQ89009.1    LBMM01009738    KMQ87908.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    KMQ94772.1    ABLF02011238    GGMR01004600    MBY17219.1    LBMM01004697    KMQ92167.1    LBMM01006496    KMQ90570.1    GFXV01002090    MBW13895.1    GGMR01011682    MBY24301.1    KU543679    AMS38363.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    ABLF02009991    ABLF02009992    ABLF02054952    GALA01001776    JAA93076.1    GALA01001777    JAA93075.1    GGMR01000779    MBY13398.1    GALA01000302    JAA94550.1    LBMM01007659    KMQ89538.1    AAZX01012143    AAZX01012194    GFXV01003903    MBW15708.1    GBHO01002982    JAG40622.1    GGMR01015159    MBY27778.1    ABLF02020969    GALX01004785    JAB63681.1    LBMM01007638    KMQ89555.1    ABLF02041886    GEHC01000964    JAV46681.1    GBXI01013438    JAD00854.1    GEHC01000915    JAV46730.1    GAPW01000192    JAC13406.1    ABLF02034925    KQ972691    KXZ75805.1    ABLF02018471    ABLF02058352    AB593326    BAK38647.1    KU543683    AMS38371.1    GGFL01001583    MBW65761.1    AB593322    BAK38641.1    ABLF02005203    ABLF02041316    GGMR01006838    MBY19457.1    GAMC01020517    JAB86038.1    AB090814    BAC57904.1    GAMC01020519    GAMC01020515    JAB86040.1   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
468
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19661
Exp number, first 60 AAs:
0.03932
Total prob of N-in:
0.00817
outside
1  -  468
 
 

Population Genetic Test Statistics

Pi
30.654304
Theta
52.923763
Tajima's D
1.777943
CLR
347.301984
CSRT
0.846007699615019
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号