SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09149
Pre Gene Modal
BGIBMGA009703
Annotation
gag-pol_polyprotein?_partial_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 2.673
 

Sequence

CDS
ATGTTTTCAAGTAAAGAATTCATAAATTTTACAGAAGACATAGAAGTAGAAATTAAATGCGCAAATAAAGAAAATTTAGTTGCAACAGCGGTCGGATATATTAATACAGATTTCGGGAAATTCGAGAATGTTCTTTATGTACCAGGAATATCTAGAAACCTAATTTCAGTGAGCTGTTTAACAGACAATGGAGCCACCGCAATTTTCGAAAATGATAAAGTTACTATTAAAAAATTAGGAAAGGTTATTTTAACCGGAATTAAAAATAAAATTGGCTTATATGAAGTTCAGATAAGAGTTCAGTTTAAGAAAGAAGTGCATATAACTGAAAGCTGCGATTTATGGCACCGTCGTTTTGGTCACGCTGCTGGAGTACAACGTTTTTCAAAATTTTTAAAGGGGATGAAAATTAAGGGAGATTTTTCGGACAATTTTTGTGAGATTTGTGTTAGGGCTAAAATGTGTAGGCATCCGTTTGGAAAAGAAAGGATAGCAGCGAAATCTCCTTTAGAGATTGTTCATACCGATCTTTGCGGCCCAATTGAATTACCCACTTGGGACAACCATAAATATTTTGTCACCTTTCTGGATGATTTTACTCATTTTTCCGCGGTTTACCTTTTATCGTCGAAAAATGATGTGTTTGATAAAATAAAACAATTTATATTTTTGGCGGAGAATCATTTTAGATTGAAAGTAAAAAAGATTAGGTGTGATAATGGGACTGAATATTCAAACAATAGTCTAATATCGTGGTGTCAAAATAAAGGAATAGTCCTGGACTTAACTATTCCATACACACCGCAATTGAATGGTAAAGCAGAGCGACTGAACCGTACTCTTATGGAGAAAACGAGAGCCTTGCTTTTGGATGGAGCTGTACCCAAATATCTCTGGGGAGAAGCATTACTAACGGCTAGCTTCTTATTAAACCGATGTCCAACAAAAGGAAAAAATAAAACTCCTGCGGAATTGTGGTTTGGAATAAAACCAGATGTTTCAAATATTCGAAGATTTGGCTCAACTACATATTTTAAAATAAATTCTGGACTAAAAAAGCTTGATGATCGTTGTAAAAAGGGTATTCTGGTTGGCTACGTTAGAAACGGTTACAAAATTTGGGTTGAAGATGAACAAAAAATTATACGAGCAAGGGATGTAAGAATTAATGAGGGAGAACAAGGAATTCTAGGTGGATACTTAGAAGATAATGAAGTAATTAATGGGCTTTGGGGTGATGAAAGGGAGAACACTAATAGAAATAACACAAATGAAAATAATCGTGCAGATGATGAAGTCAGAGAAGTTCGAGAAGGTGATTTTAGAGGAATTAATAGTAATGGAGTTAATGAAGTTCGAGAAGATGTTGTTATAAGGCAAAATAATAGAGGAAGAAATGAAAATCGAGTAGAAAGAGGAAGAATCATAAATATTGAAGAAACAGATATATTTAGTGAAACAAATGAAGAGGAAACAATTGAAGGTGAAACAAATGACAGAGGAACAAATGCAAATGAAACAAATGAAAATGGAACAAATGATAGCCCATTAACAAATGAAAATCTGGTGGAGACTTTAAGAAGTAATGATGATATGGATGAAAGAGAAGAATTTCTTGACAGTGAAAATACTGAAGGAATTAATGAACAAGTTTTAGAAAATACAAGAACTGGAAGACCACAGCGGAACAGAAGACCACCAGACAGATACAAAGATTTCATAATGGAAGACGGAGAATTCTCTTTATTAACGTTCGAGGAAGCAATTGAATCAAAAGAAAAAGAAAACTGGTTAAAAGCTATTAAAGAAGAAATGGATTCTTTAAAAGAAAATAATACATGGTCTTTAGTTGACAAGAAGGAGGCAGAAGGAAGAAAATTGGTTACAAGTAAATGGATTTTTTCTGTAAAACCTGACGGAAGATATAAAGCTAGACTTGTTGCTAGAGACAATTGA
Protein
MFSSKEFINFTEDIEVEIKCANKENLVATAVGYINTDFGKFENVLYVPGISRNLISVSCLTDNGATAIFENDKVTIKKLGKVILTGIKNKIGLYEVQIRVQFKKEVHITESCDLWHRRFGHAAGVQRFSKFLKGMKIKGDFSDNFCEICVRAKMCRHPFGKERIAAKSPLEIVHTDLCGPIELPTWDNHKYFVTFLDDFTHFSAVYLLSSKNDVFDKIKQFIFLAENHFRLKVKKIRCDNGTEYSNNSLISWCQNKGIVLDLTIPYTPQLNGKAERLNRTLMEKTRALLLDGAVPKYLWGEALLTASFLLNRCPTKGKNKTPAELWFGIKPDVSNIRRFGSTTYFKINSGLKKLDDRCKKGILVGYVRNGYKIWVEDEQKIIRARDVRINEGEQGILGGYLEDNEVINGLWGDERENTNRNNTNENNRADDEVREVREGDFRGINSNGVNEVREDVVIRQNNRGRNENRVERGRIINIEETDIFSETNEEETIEGETNDRGTNANETNENGTNDSPLTNENLVETLRSNDDMDEREEFLDSENTEGINEQVLENTRTGRPQRNRRPPDRYKDFIMEDGEFSLLTFEEAIESKEKENWLKAIKEEMDSLKENNTWSLVDKKEAEGRKLVTSKWIFSVKPDGRYKARLVARDN

Summary

Uniprot
ProteinModelPortal
PDB
3DLR     E-value=3.44807e-07,     Score=132

Ontologies

Topology

Length:
651
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00853
Exp number, first 60 AAs:
0.00068
Total prob of N-in:
0.00023
outside
1  -  651
 
 

Population Genetic Test Statistics

Pi
182.965796
Theta
155.175374
Tajima's D
0.637234
CLR
133.145996
CSRT
0.559322033898305
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号