SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09148
Pre Gene Modal
BGIBMGA009703
Annotation
hypothetical_protein_RP20_CCG021563_[Aedes_albopictus]
Location in the cell
Cytoplasmic   Reliability : 1.292 Nuclear   Reliability : 1.735
 

Sequence

CDS
ATGGAGAAAACGAGAGCCTTGCTTTTGGATGGAGCTGTACCCAAATATCTCTGGGGAGAAGCATTACTAACGGCTAGCTTCTTATTAAACCGATGTCCAACAAAAGGAAAAAATAAAACTCCTGCGGAATTGTGGTTTGGAATAAAACCAGATGTTTCAAATATTCGAAGATTTGGCTCAACTACATATTTTAAAATAAATTCTGGACTAAAAAAGCTTGATGATCGTTGTAAAAAGGGTATTCTGGTTGGCTACGTTAGAAACGGTTACAAAATTTGGGTTGAAGATGAACAAAAAATTATACGAGCAAGGGACGTAAGAATTAATGAGGGAGAACAAGGAATTCTAGGTGGATACTTAGAAGATAATGAAGTAATTAATGGGCTTTGGGGTGATGAAAGGGAGAACACTAATAGAAATAACACAAATGAAAATAATCGTGCAGATGATGAAGTCAGAGAAGTTCGAGAAGGTGATTTTAGAGGAATTAATAGTAATGGAGTTAATGAAGTTCGAGAAGATGTTGTTATAAGGCAAAATAATAGAGGAAGAAATGAAAATCGAGTAGAAAGAGGAAGAATCATAAATATTGAAGAAACAGATATATTTAGTGAAACAAATGAAGAGGAAACAATTGAAGGTGAAACAAATGACAGAGGAACAAATGCAAATGAAACAAATGAAAATGGAACAAATGATAGCCCATTAACAAATGAAAATCTGGTGGAGACTTTAAGAAGTAATGATGATATGGATGAAAGAGAAGAATTTCTTGACAGTGAAAATACTGAAGGAATTAATGAACAAGTTTTAGAAAATACAAGAACTGGAAGACCACAGCGGAACAGAAGACCACCAGACAGATACAAAGATTTCATAATGGAAGACGGAGAATTCTCTTTATTAACGTTCGAGGAAGCAATTGAATCAAAAGAAAAAGAAAACTGGTTAAAAGCTATTAAAGAAGAAATGGATTCTTTAAAAGAAAATAATACATGGTCTTTAGTTGACAAGAAGGAGGCAGAAGGAAGAAAATTGGTTACAAGTAAATGGATTTTTTCTGTAAAACCTGACGGAAGATATAAAGCTAGACTTGTTGCTAGAGACAATTGA
Protein
MEKTRALLLDGAVPKYLWGEALLTASFLLNRCPTKGKNKTPAELWFGIKPDVSNIRRFGSTTYFKINSGLKKLDDRCKKGILVGYVRNGYKIWVEDEQKIIRARDVRINEGEQGILGGYLEDNEVINGLWGDERENTNRNNTNENNRADDEVREVREGDFRGINSNGVNEVREDVVIRQNNRGRNENRVERGRIINIEETDIFSETNEEETIEGETNDRGTNANETNENGTNDSPLTNENLVETLRSNDDMDEREEFLDSENTEGINEQVLENTRTGRPQRNRRPPDRYKDFIMEDGEFSLLTFEEAIESKEKENWLKAIKEEMDSLKENNTWSLVDKKEAEGRKLVTSKWIFSVKPDGRYKARLVARDN

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
370
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.21247
Exp number, first 60 AAs:
0.21247
Total prob of N-in:
0.01916
outside
1  -  370
 
 

Population Genetic Test Statistics

Pi
131.540131
Theta
132.190981
Tajima's D
-0.161402
CLR
162.734359
CSRT
0.325533723313834
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号