SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09086  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA007515
Annotation
PREDICTED:_GRIP_and_coiled-coil_domain-containing_protein_2-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.394
 

Sequence

CDS
ATGGATAAATACAACCCAGATACATTCAGAATTGACGATTACATTGATTTTTTCGAAAACAAATGCAAAATTCTTGATATCGATAACAGCGACTTACAGAAAGATTTGCTTCTGAATTTACTAACACCAGAGATATTCCACGAATTAAAAGTAGCTTTAACGCCTGATTTCGATATAGCTACATACAGCGAAATTTGTAACAAATTATTAGACCTCTATCGCATAAAAACGACGAGGTATAGAGCCTTAACAGAATTTTGGAATTGCACTAGAGAACAAAATGAAACGATGGAACACTATGCAAACAGATTAAAAGGTCTTAGTCGGGATTGTGGCTACACTAATGACTTCCTGGAACGACAATTACGTGACCGCTTTGCCACTGGATTGAATCATCCAGATTTAGAAACCGACTTGAAACAAAAATGGCCTGATTTAGTTCAAACGGTAGACGGAATACCACGAGAAGTAACCTTCCAACAAATTTTTACAATCTCTCAATCAAGAGAACAGGCAGAACAAGACACACCACGAACAAGTATTAAAAAAATAAATAGGAGCAAAACCAAAACCGTACCATTACATCAAAATACAACACGAAAATTAAATCCAATGCATTGTTTACGCTGTGGAAAGAAAGAACGGCACAGCCTAACACAGTGTTCAGCCAAGGACCATATTTGTAAAGAATGTAACACGAAAGCACACTTTGAGAGTTGTTGCATTAAGTCTGGACGGGCATACATCAGCTATTCAGAAGGGAGCCGAAAATCAATTAAAAAAATAACAAGACCTCATAAGTCCTCAACATCATCATCATCATCTATCAGTAATAACAAAGAAGAAAGCGATGATGAAGTTATCTGCAGCGTCTTGGGTACACGTAAGAGAGAATGCAAACAAATCGATGTACGGATCAATGACATACCTTGCACTATGGATTGGGACCCCGGCTCTGCGTATTCAATAATAAACACGACATTGTGGAAAAAATTAGGATCACCATCTTTACAACCCGCCCCGAAACTCAAGGCCTACGGCAACACAAACTTAAAAACAAAGGGAATTACGAAAGTGACAGTCGAAGTCGACGGACTGCAAAAACTTCTACCTGTGGTCGTAATGAAAAATGCCAAACCAATGTTATTTGGTTTACATTGGAGTGAAGTTTTTGAAATGGAATTTCCAAAACCAGTATACTCCATCAAAACATCAACACCTATGACTCTTAAACAAATATTGGATAAACATGTACAACTCTTTGATGGAAAACTAGGAAAAGTTAACAATTATTACGTAAACATACATGTCAAACCAGAAGCTGAACCGATCCACCTTCCTGCACGGCCTATAAAATTCAGCATGAAAAAGAATATAGAAAGGGAGTTAGATCGTCTGATCTCAGAAGGGATTGTGGAAAAAGTAGATCCTAATGTTACACCTATTGAATGGGCTACACCCACAGTTAACATTTTGAAATCTACAGGGGAAGTTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACACCCAGTTCCAATTTTCGATCAACTACGCCAAAATCTCGCAAACGATACAAAGAAATGCATAGCTTCTTCACAACCATTAATTGCATTTGACGAGAAACGTCCCCTTTATTTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAACCAATTGCTTTTGCTTCAAGGAAATTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATACATATTATGGGTGCACACCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCTTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAACCTATCAGAACAGTTACTTATGAAAACAACTTCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGAATACAATCCAGAAATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTCATGAGGCAAGGACGCATCGTTATACCTACAGCACTACGAAAAGCCATTCTTACATACCTTCATCGAGGACATCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGACCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCTCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAATCTATTTTACATGTCACATCATCTCCATATCATCCTCGGACAAATGGACTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTTTGTTTACATACAGAAACACTCCGCACTCGTCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGACGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGATTAATGCAGTATTTACAAGTAAAAGAAAACATTCGTACCACATCACCGAGTTACCGACCAAGTGACCAAGTATATATAAAAACACGCAATGATAAAATATGGGAACCAGCGAAAATCAATTTCATGATGGAAGCGATTCAGAACCATCCGAGTCAAGATGGACCACCAAAAAAGAGTCCTTTTGATGAATTAAGCAGAGAAGATTTGATCCATAAATGCAAGGGTTTACTTGTAATAGCTCAGAAAGCTAAGCAAGCTAAATCAGAATTACAAGCTGAATTAGAAACTAACAAAAATAAAGTTGAGAAATTGGAAAATAGTGAAAAAAATAACAAAGAAAATTTAAAAACTCTTCAAGAGCTTGTTGATTCTTTGACAGAACAAAAACTAAACTTCATAACTGAAGTGGATTCAGCTCATACAAAAGTAAAAGAACTAAATAAAAAAGTCAATCAATATAATGAAGAAATAAAGCAGTACAAAGCTGATTTGATTGTGAAGGACAATAAAATATGCATGATATCTCAAAAATTATCAGATCTGGATTGTGAAATAATTTCATTGCGAAGACAGAATACTAGACTTTTAGAAGAAAATGAACAGCTGATTAATCAACTCTCTGAAATTGAAGCTAAAACTGTGGAGGTGAACAATATAGGTCTTCAGCAGCAGGAACAATTAAAGATTTTAGAAGAAAATGTACAGAAAGATTCAGAAAATTGCAAACAAATAGAAGAGCTTCAATTGAAAATTATAAGTTTAGAAAAAAAACTTGAATCAGAAAAACAAACAAAGATTGTCGATTATGAAAATAAGGTACAAGAATTCACTGAACTATATGAAAATGAGAAAGCTAAAAAAGAAAAATTGAATATTAAATTAAAGAGTTACAAAGAAAAGATTCTTAAATGTGCAGTTTGTATAAATCAACTTAAAAATACAAGATTTATTTTGGCCAAAACAGTGAAAGAATATTCTGAAAATATCCCTAAGTGGCAAGAAGATATAATAAAAGCATCAAAAGAATTGGACATTCAAATTAATCACCTTAAGTCAGAAAATACTATTTTAAGAGATAAATTACAGCAAGTGGAGTCGCAACTTGATGTATTAAGCAAAGGTGAAATTGATGAATCACAATTGAGTAAAACTAACTCACTAAATGAGACTTTAAAAATTGAAAATATGACACTAAAACAAGAGTTTGAGAAAATATCACATCAAAATCGTAAATTAGTGAAAGATTTATCAGAAGTGCAGGGTAATTATGAGCACCTTATTAATACGGAACTTCCGGCACATATAAATGCCGAAAAATTATTAACAAAAGAATTAGACGAAATTAAACAACAGTTAAGTGAAATAAAATGCAGAAATATCGAACTTGAAGAAAGTTTTGAAAATGCAAAATACGATTTGTCTCAGTCAATTCAAAGCACAATGCAAACCAATCAAGACCATGAAAACTTATTACTCCAACTCAAGGCTTTAGAAAGCGAAAAGGATATTTTAGTTAAAGAAAAACTAAATGCTAAAGATAGTATTATAGAATTGGAACACAAAAATAAAGTTTTAAGTGACCAAGTAACCAAAATGTCTTTTGAAAATAAGACTATCAATTCGAAGTTAGATACTTTATCACAGCAAAAACTGCAACTCGAGAAAAACTTTGCAGCTGAAAAAGAAAGTCAAGTAAATTTATTAAAGTGCGATTTGATGACAGTGCAGGAACAATATAGTAGATTGAAAAAAGAGTTTGATGACTTGCAAGATTTAAACAGCCTACTGAAAGAAGAAGTAGATACTTTAAAACTGTCATTAGAGCAACCAAGCGACGATACTGAAAATTTTTCTGATTTGAATGTATCATTACAGGCCGACATTGTAAAATTAGAAACAAAATTGTCTTTATATAAACAAGAGAATTCAGCGCTTTTAGTGGAACTAAAAGAATCTCGAATTAAAATCAAAGAATATGATTCTCTGTTTGCTGAATATGAAGAAGCTAAATCAAAGTTGCAAAGCTATAAAACTGAAAATACTGAATTATTGAATGAAATGAAAGAAATAAATCAAGTTTTAAAAGAACGCGGTGAATCTATATCAAAATTGCAAAAAGCCATTATTGAAATGGAAAGGTTGATCGAGAGTTTGGAAAAAGAAAGAGAAATTTCAACTAACAACAACACTGAACTAACTAAAAAAATTGAAAAATTAGAAAACCAAATAAAAACAGCTGAAAAATCTTCTACGAAAACAAATGAATTTACCGATACATTAACTGCTGAAAGAGATAGTGCTATTAAAATGTTGGAAGAAAAAGATATTATAATAATATCTTTAAAAGATGAAATTGAGAAACTCAAACATCAGTCACTAAATTCATCAGAGGTTCCAAACGAAGATAACATGTCCACTTCTACCATGTCAAAAGCAGATGAAACTGCGAGAATGAGAGATTTAGATGAAACTTTTGAGGAAAAGTATACGAAACTGAGGCTATTTGCATTAAAACTTAAGAAAAAACTGACTGAAACTGTAACTCAACTACAAAAAACAGAAGAAGATAAAGTCAGACTTGAAAAATTAATAAACGAAAATTCCGCGGAAGTACATAAAAATGGAAAATTAGAAGTACCTATGTTACAGGAAAAAGTAGAGTCATTAACTTCTGCTATTAATGTAGCTGAGAAGAACAATGCTGAAATCGAGAAGATAAAAGCTGAACTACACGCTATAAGTCAACAGTTGGCTTCGGAAATTGAAGCTCATAAGGTGACCAAGGAGAATTTAGAAAAGGCTAAACGAGATGTTAAGAAGAAAAATGTCCTAAGTCTTGAAATGGAAGACTACGAAAGGTCAATGAAAGAACTTACGTCGAAGATGGAGGAAAATAGGAAAAAGATGATTCAGATGGAATCGACAATAGATACCCACGAGGGAACTATTACCGCGATGAAAACACAAATCAAACTACTAGAGGATCAAATAAATACAGAAGAAACCCAAAACAGGCTCCTGAAAGAGGAACTTCAGCAAGCCATTGAAGGTCTCAAACAGAAAGATGATGTGATTCAGATAAAGAACAACATCATAATAAAGCTAGAACAAAATCTTGAAGATGAGAAGCATAAAAATGAAGAATGTGATCTTGAAACGACTTTAATTCTAAGTGAAAAAGAAAAGATTATAATTGCTCTAGGAGATGAAAAAGTGGAACTAAGTAATAAGGTGAAAAAGTTGGAATTCAAATGTGCCGAGCTAAACGAAAATTTAAGAATTTTAAATATTGAATTGGCTGATTTGAAAACTGAATATACAAGCTATAAGGTGCGGGCTCAGGCGGTATTACGACAGAATCAGACCGTGGACCACAGTCAAGAAGAACAACTGAAGGAAGAAACAGCAGCGCTAAGAGCGCAGATCGAGACTCTTACAGCTAAACTAAAAACTGCACAGGAGGAGTGTGAATTACAAACAAGCGAGGCGGAGAGCGCGCGGAGACGTGCCGCTGAAGCATCTAACGAAGCGAGCCGAGCGCAGCAACGCACCGCGAGACTGCAGGGCGACCTCACGCGGCTAGGCCACCAACTAGATTCTGAAAGAACGCAACATAAACTACAGGTTTCAACTCTAACCCAATGTTATAAGACACAAATAATTGAATTGGAGACAAAGCTTAGAAACGAGACGGAAAATCTCAAGAAACAGTTGGCTTTGGCCCAGGAGAACACGAAAATTAACAGGCCCAGTGCTCCTATTGAATCATCCAGTCAATATATGCTGCCAGTTATTCATAAAGATGATGGCAGCGAAACAGACCTGGAGATTAATGTGTCCATGATACCTAGAGAAGAAGGAGAGGTATGA
Protein
MDKYNPDTFRIDDYIDFFENKCKILDIDNSDLQKDLLLNLLTPEIFHELKVALTPDFDIATYSEICNKLLDLYRIKTTRYRALTEFWNCTREQNETMEHYANRLKGLSRDCGYTNDFLERQLRDRFATGLNHPDLETDLKQKWPDLVQTVDGIPREVTFQQIFTISQSREQAEQDTPRTSIKKINRSKTKTVPLHQNTTRKLNPMHCLRCGKKERHSLTQCSAKDHICKECNTKAHFESCCIKSGRAYISYSEGSRKSIKKITRPHKSSTSSSSSISNNKEESDDEVICSVLGTRKRECKQIDVRINDIPCTMDWDPGSAYSIINTTLWKKLGSPSLQPAPKLKAYGNTNLKTKGITKVTVEVDGLQKLLPVVVMKNAKPMLFGLHWSEVFEMEFPKPVYSIKTSTPMTLKQILDKHVQLFDGKLGKVNNYYVNIHVKPEAEPIHLPARPIKFSMKKNIERELDRLISEGIVEKVDPNVTPIEWATPTVNILKSTGEVRICGDYRTTLNPVLIKHLHPVPIFDQLRQNLANDTKKCIASSQPLIAFDEKRPLYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLIHIMGAHRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTSKDHILTKVCQNLKTGWRESEYNPEMKPFYRNRTELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIRTTSPSYRPSDQVYIKTRNDKIWEPAKINFMMEAIQNHPSQDGPPKKSPFDELSREDLIHKCKGLLVIAQKAKQAKSELQAELETNKNKVEKLENSEKNNKENLKTLQELVDSLTEQKLNFITEVDSAHTKVKELNKKVNQYNEEIKQYKADLIVKDNKICMISQKLSDLDCEIISLRRQNTRLLEENEQLINQLSEIEAKTVEVNNIGLQQQEQLKILEENVQKDSENCKQIEELQLKIISLEKKLESEKQTKIVDYENKVQEFTELYENEKAKKEKLNIKLKSYKEKILKCAVCINQLKNTRFILAKTVKEYSENIPKWQEDIIKASKELDIQINHLKSENTILRDKLQQVESQLDVLSKGEIDESQLSKTNSLNETLKIENMTLKQEFEKISHQNRKLVKDLSEVQGNYEHLINTELPAHINAEKLLTKELDEIKQQLSEIKCRNIELEESFENAKYDLSQSIQSTMQTNQDHENLLLQLKALESEKDILVKEKLNAKDSIIELEHKNKVLSDQVTKMSFENKTINSKLDTLSQQKLQLEKNFAAEKESQVNLLKCDLMTVQEQYSRLKKEFDDLQDLNSLLKEEVDTLKLSLEQPSDDTENFSDLNVSLQADIVKLETKLSLYKQENSALLVELKESRIKIKEYDSLFAEYEEAKSKLQSYKTENTELLNEMKEINQVLKERGESISKLQKAIIEMERLIESLEKEREISTNNNTELTKKIEKLENQIKTAEKSSTKTNEFTDTLTAERDSAIKMLEEKDIIIISLKDEIEKLKHQSLNSSEVPNEDNMSTSTMSKADETARMRDLDETFEEKYTKLRLFALKLKKKLTETVTQLQKTEEDKVRLEKLINENSAEVHKNGKLEVPMLQEKVESLTSAINVAEKNNAEIEKIKAELHAISQQLASEIEAHKVTKENLEKAKRDVKKKNVLSLEMEDYERSMKELTSKMEENRKKMIQMESTIDTHEGTITAMKTQIKLLEDQINTEETQNRLLKEELQQAIEGLKQKDDVIQIKNNIIIKLEQNLEDEKHKNEECDLETTLILSEKEKIIIALGDEKVELSNKVKKLEFKCAELNENLRILNIELADLKTEYTSYKVRAQAVLRQNQTVDHSQEEQLKEETAALRAQIETLTAKLKTAQEECELQTSEAESARRRAAEASNEASRAQQRTARLQGDLTRLGHQLDSERTQHKLQVSTLTQCYKTQIIELETKLRNETENLKKQLALAQENTKINRPSAPIESSSQYMLPVIHKDDGSETDLEINVSMIPREEGEV

Summary

Uniprot
ProteinModelPortal
PDB
3S3O     E-value=1.6224e-16,     Score=218

Ontologies

Topology

Length:
2286
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00017
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.00001
outside
1  -  2286
 
 

Population Genetic Test Statistics

Pi
259.484536
Theta
199.140213
Tajima's D
0.796148
CLR
0.265567
CSRT
0.594020298985051
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号