SGID The Silkworm Genome Information Database
Gene
KWMTBOMO09058  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA007585
Annotation
nuclear_cap-binding_protein_subunit_2_[Bombyx_mori]
Full name
Nuclear cap-binding protein subunit 2       + More
Nuclear cap-binding protein subunit 2B      
Nuclear cap-binding protein subunit 2-A      
Alternative Name
20 kDa nuclear cap-binding protein
NCBP 20 kDa subunit
20 kDa nuclear cap-binding protein B
NCBP 20 kDa subunit B
20 kDa nuclear cap-binding protein A
NCBP 20 kDa subunit A
Location in the cell
Nuclear   Reliability : 2.696
 

Sequence

CDS
ATGAAGCGCAGTTATGATTCTATGAATTCTTCAATTGAAATAAGTTCCTATCGTGACCAACATTTTAAGGGATCCAGAAGCGAACAAGAAAAATTACTAAAAGCTTCGTCAACGCTTTACATTGGAAACCTTTCATTTTACACAACAGAAGAGCAAATTTATGAACTGTATTCACGATGCGGAGATATAAGAAGAGTAATAATGGGACTAGACAAATACAAGAAAACACCTTGTGGATTTTGTTTTGTAGAATACTATGCGCGGGAAGATGCCGAAAATTGTATGAGGTATATAAATGGCACGAGGCTGGATGACCGAATAATTCGCTGTGACTGGGATGCTGGATTCATTGAAGGTCGACAGTACGGTCGTGGCAAAACAGGAGGCCAGGTTAGAGATGAATATCGAACTGACTATGACGGTGGGCGTGGCGGTTATGGAAAAATAATAGCACAGAAAATAAACCCAAATACCCTAGAACGTTAA
Protein
MKRSYDSMNSSIEISSYRDQHFKGSRSEQEKLLKASSTLYIGNLSFYTTEEQIYELYSRCGDIRRVIMGLDKYKKTPCGFCFVEYYAREDAENCMRYINGTRLDDRIIRCDWDAGFIEGRQYGRGKTGGQVRDEYRTDYDGGRGGYGKIIAQKINPNTLER

Summary

Description
Component of the cap-binding complex (CBC), which binds co-transcriptionally to the 5' cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi). The CBC complex is involved in miRNA-mediated RNA interference and is required for primary microRNAs (miRNAs) processing. Also involved in innate immunity via the short interfering RNAs (siRNAs) processing machinery by restricting the viral RNA production. In the CBC complex, Cbp20 recognizes and binds capped RNAs (m7GpppG-capped RNA) but requires Cbp80 to stabilize the movement of its N-terminal loop and lock the CBC into a high affinity cap-binding state with the cap structure.
Component of the cap-binding complex (CBC), which binds co-transcriptionally to the 5' cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi). The CBC complex is involved in miRNA-mediated RNA interference and is required for primary microRNAs (miRNAs) processing. Also involved in innate immunity via the short interfering RNAs (siRNAs) processing machinery by restricting the viral RNA production. In the CBC complex, Cbp20 recognizes and binds capped RNAs (m7GpppG-capped RNA) but requires Cbp80 to stabilize the movement of its N-terminal loop and lock the CBC into a high affinity cap-binding state with the cap structure (By similarity).
Component of the cap-binding complex (CBC), which binds co-transcriptionally to the 5' cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi). The CBC complex is involved in miRNA-mediated RNA interference via its interaction with Ars2 and is required for primary microRNAs (miRNAs) processing. Also involved in innate immunity via the short interfering RNAs (siRNAs) processing machinery by restricting the viral RNA production. In the CBC complex, Cbp20 recognizes and binds capped RNAs (m7GpppG-capped RNA) but requires Cbp80 to stabilize the movement of its N-terminal loop and lock the CBC into a high affinity cap-binding state with the cap structure (By similarity).
Component of the cap-binding complex (CBC), which binds co-transcriptionally to the 5' cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi). The CBC complex is involved in miRNA-mediated RNA interference via its interaction with Ars2 and is required for primary microRNAs (miRNAs) processing. Also involved in innate immunity via the short interfering RNAs (siRNAs) processing machinery by restricting the viral RNA production. In the CBC complex, Cbp20 recognizes and binds capped RNAs (m7GpppG-capped RNA) but requires Cbp80 to stabilize the movement of its N-terminal loop and lock the CBC into a high affinity cap-binding state with the cap structure.
Subunit
Component of the nuclear cap-binding complex (CBC), a heterodimer composed of Cbp80 and Cbp20 that interacts with m7GpppG-capped RNA.
Component of the nuclear cap-binding complex (CBC), a heterodimer composed of Cbp80 and Cbp20 that interacts with m7GpppG-capped RNA. Interacts with Ars2 (By similarity).
Component of the nuclear cap-binding complex (CBC), a heterodimer composed of Cbp80 and Cbp20 that interacts with m7GpppG-capped RNA (By similarity). Interacts with Ars2.
Similarity
Belongs to the RRM NCBP2 family.
Keywords
Complete proteome   mRNA processing   mRNA splicing   Nucleus   Reference proteome   RNA-binding   RNA-mediated gene silencing  
Feature
chain  Nuclear cap-binding protein subunit 2
EMBL
BABH01030165    BABH01030166    BABH01030167    GAIX01003754    JAA88806.1    DQ497196    + More
AK402010    KQ459602    BAM18632.1    KPI93403.1    KQ460615    KPJ13659.1    ODYU01009673    SOQ54263.1    NWSH01004559    PCG64949.1    RSAL01000033    RVE51440.1    AGBW02013542    OWR43242.1    JN383803    AEN04479.1    KQ414645    KOC66623.1    KZ288311    PBC28485.1    JR038394    AEY58236.1    KQ434775    KZC04069.1    UFQT01000006    SSX17440.1    GL436457    EFN71924.1    GEZM01037472    JAV82055.1    GL451657    EFN78824.1    JR038393    AEY58235.1    SAUD01036024    SAUD01021932    RXG53043.1    RXG57328.1    GBYB01006046    JAG75813.1    LBMM01007405    KMQ89756.1    GECZ01001309    JAS68460.1    GANO01001670    JAB58201.1    KQ971343    KYB27267.1    CH964232    KQ978456    KYM93882.1    GEBQ01030836    JAT09141.1    CH933806    CCAG010010183    JXJN01016227    OUUW01000007    SPP83442.1    CH954181    KQ977606    KYN01432.1    CH902617    KK852751    KDR17129.1    EFA03363.2    NNAY01003394    OXU19488.1    CH916374    CH940650    APGK01044818    KB741028    KB632297    ENN74806.1    ERL91700.1    GEDC01015120    JAS22178.1    CP012526    ALC46492.1    CM000160    KQ982014    KYN30650.1    GL887844    EGI69835.1    ADTU01022743    KK107183    QOIP01000011    EZA55888.1    RLU17249.1    KQ976745    KYM75465.1    GALX01002731    JAB65735.1    GFDF01008451    JAV05633.1    DS235853    EEB18819.1    GBBL01002185    JAC25135.1    KX531599    ANY27409.1    CM000364    CH480827    AJ238969    AE014297    AY070578    GL766616    EFZ14881.1    CM000070    CH479185    GFAC01006825    JAT92363.1    KQ978730    KYN28922.1    GAMC01009165    GAMC01009163    JAB97392.1    GDHF01013046    JAI39268.1    GAKP01003097    JAC55855.1    JH431723    APCN01000326    AAAB01008859    AXCN02000007    GBBM01002911    JAC32507.1    CH940651    GEFH01002367    JAP66214.1    GFDL01010763    JAV24282.1    CH477376    GBBM01002938    JAC32480.1    JO844429    AEO36046.1    GFAA01001309    JAU02126.1    AXCM01002097    GGFJ01010152    MBW59293.1    GACK01006303    JAA58731.1    GADI01008206    JAA65602.1    GAMD01003189    JAA98401.1    GGFK01011966    MBW45287.1    DS656359    GBBI01000777    JAC17935.1    ADMH02001312    ETN63045.1    GBHO01038539    GBRD01007595    GDHC01012631    JAG05065.1    JAG58226.1    JAQ05998.1   
Pfam
PF00076   RRM_1
Interpro
IPR027157   NCBP2        + More
IPR035979   RBD_domain_sf       
IPR034148   NCBP2_RRM       
IPR012677   Nucleotide-bd_a/b_plait_sf       
IPR000504   RRM_dom       
SUPFAM
SSF54928   SSF54928       
Gene 3D
PDB
6D0Y     E-value=2.93098e-51,     Score=504

Ontologies

Topology

Subcellular location
Nucleus  
Length:
161
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00875
Exp number, first 60 AAs:
0.00875
Total prob of N-in:
0.40636
outside
1  -  161
 
 

Population Genetic Test Statistics

Pi
205.061487
Theta
173.860589
Tajima's D
2.66624
CLR
0.902967
CSRT
0.960601969901505
Interpretation
Uncertain
Peptides ×
Source Sequence Identity Evalue
26822097 CDWDAGFIEGR 100.00 2e-04
26280517 TPASTSDNITCDNR 100.00 2e-04
28467696 TPASTSDNITCDNR 100.00 2e-04
26822097 IWDMSDNPTTTPNQIVIR 100.00 0.006
26280517 AYAIIIASR 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号

渝公网安备 50010602502065号