SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09044
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.463
 

Sequence

CDS
ATGAATAGAGGGTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGATCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTGGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCACGGCGCAATGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGAGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCGGCAGCTGCGGGACATCGTTTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTTGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGCGAAGCCCCTGCCGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGTCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGGCTTTATAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTTGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCACCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGTATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCTTTTAACACCCTGCCCTGGTCCGTGATAAGGGGAGCGCTGGAACGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTACTGAGGGGTGCCCTCCTCCCGGGCCTAAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAAAATCTGGTCCCTCGTCTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTTCCCAACGTTGGGGGGCCTGACCAGTTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGCGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCACGGGGCGTGGCACGTCCCAGCCCCAGTGTGGTTAGAGCACGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGTTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCTGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTTGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCAATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGCGAGACGCGCAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATTTCGCCCAAGCCCTGGCCCTCTAA
Protein
MNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMESLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPRQLRDIVSALFPQEREGFVAPAMDAPPEYDGEAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTATGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSGGGVALAVSLDIANAFNTLPWSVIRGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQLTRRLYTGVVRSMALYGAPAWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSVGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAELTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADFAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078935    BAC06462.1    + More
AB078929    BAC06452.1    AB078930    BAC06454.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    AB078936    BAC06464.1    LBMM01006954    KMQ90166.1    LBMM01006671    KMQ90407.1    LBMM01006657    KMQ90417.1    LBMM01004272    KMQ92618.1    LBMM01007036    KMQ90099.1    LBMM01002052    KMQ95336.1    LBMM01015025    KMQ84953.1    LBMM01007425    KMQ89740.1    LBMM01008448    KMQ88867.1    LBMM01004634    KMQ92224.1    LBMM01003988    KMQ92922.1    LBMM01008422    KMQ88894.1    LBMM01012412    KMQ86235.1    LBMM01005948    KMQ91066.1    RSAL01003504    RVE40273.1    LBMM01008278    KMQ89009.1    LBMM01002480    KMQ94776.1    LBMM01014122    KMQ85315.1    LBMM01005474    KMQ91485.1    LBMM01005733    KMQ91252.1    LBMM01004262    KMQ92649.1    LBMM01004505    KMQ92346.1    ABLF02011238    LBMM01015018    KMQ84954.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01015285    KMQ84870.1    GGMR01015159    MBY27778.1    LBMM01005465    KMQ91492.1    ABLF02034925    GGMR01000779    MBY13398.1    LBMM01004261    KMQ92650.1    LBMM01008445    KMQ88871.1    GGMR01014195    MBY26814.1    ABLF02013358    ABLF02013361    ABLF02054869    GGMR01006838    MBY19457.1    GFXV01002090    MBW13895.1    ABLF02018808    LBMM01008226    KMQ89040.1    GAPW01000192    JAC13406.1    ABLF02041886    GGMR01004600    MBY17219.1    GEHC01000915    JAV46730.1    LBMM01005216    KMQ91703.1    GGMR01012748    MBY25367.1    GALA01001777    JAA93075.1    GGFJ01001369    MBW50510.1    ABLF02011183    ABLF02041884    KQ971309    EEZ99146.1    GFXV01003903    MBW15708.1    GGFJ01001370    MBW50511.1    KU543683    AMS38371.1    GGFJ01001727    MBW50868.1    ABLF02018942    ABLF02041885    LBMM01009535    KMQ88053.1    GGFL01004044    MBW68222.1    ABLF02004854    ABLF02041317    ABLF02023257    ABLF02014650    GGFJ01001439    MBW50580.1    AB593327    BAK38648.1    GAKP01002292    JAC56660.1    AB090815    BAC57906.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    ABLF02041557    KQ972226    KYB24577.1    GGMR01019493    MBY32112.1    ABLF02014378    ABLF02004597    ABLF02041324    LBMM01013668    KMQ85535.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=2.89449e-05,     Score=117

Ontologies

Topology

Length:
902
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11251
Exp number, first 60 AAs:
0.0042
Total prob of N-in:
0.00057
outside
1  -  902
 
 

Population Genetic Test Statistics

Pi
0.418184
Theta
0.160657
Tajima's D
1.464059
CLR
0
CSRT
0.907354632268387
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号