SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09040
Annotation
NA
Location in the cell
Nuclear   Reliability : 2.166
 

Sequence

CDS
ATGAACTTCAAGAGTTCTGCAACCAGCTCTTCTACGGTCTGTGGCAGTTGTGGAGTTGGGGGCTCAGGCTGTGGGGGCTCTTCGGGTGCTGGGGGTTCAGGTTTTGGAGGTTCTTCAGGTTTTGGTGGTTCAGGCTGTGCAGGTTCCTCTGGTGCTGGTGGTTCTGGCTGTGCAGGTTCCTCTGGTGCTGGAGGTTCAGGCTGTGGATGTTCTTCTGGTGCTGGAGGTTCAGGCTGTGCAGGTTCTTCTGGTGCTGGGGGTTCAGGCAGTGCAGGTTCCTCTGGTGCTGGAGGTTCAGGCTGTGGAGGTTCCTCTGGTGCTGGGGGTTCAGGCTGTGCAGGCTCTTCTGGTGCTGGGGGTTCAGGCAGTTCAGGTTCCTCTGGTGCTGGAGGTTCAGGCTGTGTAGGTTCTTCTGGTGCTGGGGGTTCAGGCTTTGGAGGTTCCTCTGGTGCTGGAGGCTCAGGCTGTGGAGGTTCCTCTGGTGCTGGGGGTTCAGGCTGTGGAGGTTCCTCTGGTGCCGGGGGTTCAGGCTGTGCAGGTTCCTCTGGTGCTGGGGGTTCAGGTTTTGCAGGTTCCTCTGGTGCTGGGGGTTCAGGCTGTGGAGGTTCCTCTGGTGCCGGGGGTTCAGGCTGTGCAGGTTCCTCTGGTGCTGGGGGTTCAGGCTGTGGAGGTTCCTCTGGTGCCGGGGGTTCAGGCTGTGCAGGTTCCTCTGGTGCTGGAGGTTCAGGCTGTGGAGGTTCCTCTGGTGCCGGGGGTTCAGGCTGTGCAGGTTCCTCTGGTGCTGGAGGTTCAGGCTGTGGAGGTTCCTCTGGTGCTGGAGGTTCAGGCTGTGGAGGTTCCTCTGGTGCCGGGGGTTCAGGCTGTGCAGGTTCCTCTGGTGCTGGAGGTTCAGGCTGTGTAGGCTCCTCTGGTGCTGGGGGTTCAGGCAGTGCAGGTTTCTCTGATGCTGGGGGTTCAGGCAGTGCAGGTTCCTCTGGTGCTGGGGGTTCAGGCTGA
Protein
MNFKSSATSSSTVCGSCGVGGSGCGGSSGAGGSGFGGSSGFGGSGCAGSSGAGGSGCAGSSGAGGSGCGCSSGAGGSGCAGSSGAGGSGSAGSSGAGGSGCGGSSGAGGSGCAGSSGAGGSGSSGSSGAGGSGCVGSSGAGGSGFGGSSGAGGSGCGGSSGAGGSGCGGSSGAGGSGCAGSSGAGGSGFAGSSGAGGSGCGGSSGAGGSGCAGSSGAGGSGCGGSSGAGGSGCAGSSGAGGSGCGGSSGAGGSGCAGSSGAGGSGCGGSSGAGGSGCGGSSGAGGSGCAGSSGAGGSGCVGSSGAGGSGSAGFSDAGGSGSAGSSGAGGSG

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
331
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.296630000000001
Exp number, first 60 AAs:
0.29516
Total prob of N-in:
0.03536
outside
1  -  331
 
 

Population Genetic Test Statistics

Pi
273.747691
Theta
178.897899
Tajima's D
1.658617
CLR
0.48925
CSRT
0.819759012049397
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号