SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO09027
Annotation
PREDICTED:_uncharacterized_protein_LOC106709547_[Papilio_machaon]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 2.414
 

Sequence

CDS
ATGAAGATGAATGAAGTAACGACCAAATTTTACCACATCTTGAGTACCTTAGACAGGCAGTATGCAGCCGAAGTTGCAGACATTCTTACCGGCCCACCTGACTACAATCGACTCAAAGATGAGCTCATCAAGAGACTGTCAGTGTCGCAGGAGAATAAGGTGAAGCAGTTGCTCATGCACGAACAGCTCGGATGCCGCAAGCCTTCACAATTCCTACGGCATCTGCAACATCTCGCTGGTCCCGGATTACCTGAGGACTTCGTCAAAACAATTTGGACAAGCCGTCTACCCTCTGGATTGCAGCCAATCATCGCTTCGCAGCCATCGTTGTCTCTCGACGCACTGGCGGAACTTGCCGATCGGGTTAATGACATCGCGACCCCGGTACCGCAGGTAGCAAGCGCTACCACGTCTACACATATCGACGAGTTGACACGACAGGTAGCAGAGTTGACAAAACAAGTAAGTGCACTGACCGCGCAAGTCAACCATCGCCCAAGCAGAGCACAACGGCGACCGAAACAGCGCAGCAGATCTTCATCTCGCCGCCGGTCACAGTCTAACTACAGACAGCACCCCATATGTTGGTATCACTTCAAATATGGTACCAAAGCCGTCAGATGTGTCCAGCCGTGCGACTACAAGGCGTCGGAAAACAGTCAACAGTCCGGACAGTCGCTGATGGCGACACAAGACTGCCGCAACACCACGGGTCGCCTCTTCATCACGGACAGTAAAACTAAAAATCAATTCCTTATTGATACCGGTAGTGATATTTGTGTCTACCCAGTGTCCGCACTTCGAGAGCGTCGTTATAAAACTTCTTTTCAACTCAGTGCCGCGAATGGTTCAGTGATAGACACGTATGGATATATCGAACTTAATCTTAATTTAGGTTTACGTCGTGACTTTCCATGGCGCTTTGTTGTTGCTGATGTCACGATGGCTATTATTGGTGTTGATTTTCTTTCACATTACAACCTTATTGTTGACATCAGCAACCAACAACTTATTGATACTTTAACCAATCTTAAGTTTGTAACATCTATATGTAAAAATAATTGTCTTGTCACAAGTGTAAAAATTCCAACTGGTGGTAGTGGTAGGTATCATAACATTTTGGCACAATATCCGGAAATAACTCGCCCCGCTGGTACTCCGGGTATCGTCAGACATCACACGACACACCACATCATCACCACACCAGGTCCACCTGTATCGCTGCCGCCCCGTCGTCTCGCCCCAGATAAATTGAGAATCGCCAAGCAGGAGTTCGATGCTATGCTACGTAACGGCACGGCACGCCCTTCCTGCAGCCCTTGGGCATCACCACTGCATCTGGTGTCGAAAAAAAAAGACGACGGCTGGCGTCCATGTGGCGACTACAGGTCATTGAATGCACGAACCATACCCGACAAATATCCTATTCGTCATATACATGACTTTTCACATTGTTTGTCCGGATGCACAATTTTCTCTGTTGTCGATTTACAAAAAGCTTATAATCAGATACCAGTAGCTAAGGACGACATTTTAAAGACAGCGATCACAACACCTTTTGGATTATTCGAATTTCCGTATATGACGTTCGGGCTGCGCAATGCCGCGCAAACTTTTCAAAGATTCGCTGACGAGATGACGCGTGGACTGGATTTTATATTTCCTTATATCGACGATTTTTTAATTTTTAGCAGGTCAGCCCAGGAGCACGAAGACCACTTGCACCAACTCTTCACACGCATGAAAGAGTATGGCGTTTTGGTTAATACTACCAAATGTGTCTTCGGCGTCCCAGAAGTCACTTTTTTGGGTTACCAAATCTCCGAGAAGGGTACCAAGCCTCTGGTAAGCAAGGTCGAGGCTATCTCAAATTTTCCTGTCCCAAAAACCGTCAGAGAACTCCGGCGGTTTTTGGGCATGATAAATTTTTATCGCCGATTCCTACCCAATGCTGCCCAGATACAAGCGCCTCTCAATGCATTGCTAGTTGGTTCCGTAAAAGGTGCACAACCCGTAGTTATCGAGGGAAAGTCATTGCAAGCCTTCCAAGACTGCAAAACCAGCCTATGCAATGCAGCTCTCCTAGCCCATCCCGATACTCAAGCAAAGTTGAGTCTCGTGACAGATGCTTCGGACTCTGCAATAGGTGGAGTACTCCAGCAGCTTAAAGGTGGAGATTGGCAGCCGTTAGCATTTTTCTCTCGAAAATTGAGCCCCTCGCAGTCAAAATACTCGCCGTACGACCGAGAGCTTCTCGCCATTTATGAGAGCATAAAATACTTCCGGCATATGCTGGAAGCAACAAACTTTACTGTGTATACTGACCACAAACCTTTATGTTATGCATTTCAGCAGCCGAAGCATAACTGTTCGCCGCGTCAGTACAGACATCTGGACTTCATTTCCCAGTTCACCACGGACATAAGGTTTGTTTCGGGCAAAGACAACCTTGTCGCTGACACCTTGTCTCGCATCTGTGAACTGCAGATGCCTGTTGACTTGGAAGAAATGGCCAAATTACAAACCACAGATCCGGAGCTGGCAGAACATTTAGCAGGTGGAACATCTTTACGCCTGACTAAGATGAGCGTCCCTGGAAGTCAAGCTGTTTTATACTGCGACGTCAGTACGCAGATGCCCAGGCCGTTCGTCCCACGAGAGATGCGTCAGAAGGTATTTCAGTTCCTTCATTCACTCAGCCACCCTGGTCCCGGCGAAATATATCGCCGCCGCTATACTGCAGTTATCGCCTGA
Protein
MKMNEVTTKFYHILSTLDRQYAAEVADILTGPPDYNRLKDELIKRLSVSQENKVKQLLMHEQLGCRKPSQFLRHLQHLAGPGLPEDFVKTIWTSRLPSGLQPIIASQPSLSLDALAELADRVNDIATPVPQVASATTSTHIDELTRQVAELTKQVSALTAQVNHRPSRAQRRPKQRSRSSSRRRSQSNYRQHPICWYHFKYGTKAVRCVQPCDYKASENSQQSGQSLMATQDCRNTTGRLFITDSKTKNQFLIDTGSDICVYPVSALRERRYKTSFQLSAANGSVIDTYGYIELNLNLGLRRDFPWRFVVADVTMAIIGVDFLSHYNLIVDISNQQLIDTLTNLKFVTSICKNNCLVTSVKIPTGGSGRYHNILAQYPEITRPAGTPGIVRHHTTHHIITTPGPPVSLPPRRLAPDKLRIAKQEFDAMLRNGTARPSCSPWASPLHLVSKKKDDGWRPCGDYRSLNARTIPDKYPIRHIHDFSHCLSGCTIFSVVDLQKAYNQIPVAKDDILKTAITTPFGLFEFPYMTFGLRNAAQTFQRFADEMTRGLDFIFPYIDDFLIFSRSAQEHEDHLHQLFTRMKEYGVLVNTTKCVFGVPEVTFLGYQISEKGTKPLVSKVEAISNFPVPKTVRELRRFLGMINFYRRFLPNAAQIQAPLNALLVGSVKGAQPVVIEGKSLQAFQDCKTSLCNAALLAHPDTQAKLSLVTDASDSAIGGVLQQLKGGDWQPLAFFSRKLSPSQSKYSPYDRELLAIYESIKYFRHMLEATNFTVYTDHKPLCYAFQQPKHNCSPRQYRHLDFISQFTTDIRFVSGKDNLVADTLSRICELQMPVDLEEMAKLQTTDPELAEHLAGGTSLRLTKMSVPGSQAVLYCDVSTQMPRPFVPREMRQKVFQFLHSLSHPGPGEIYRRRYTAVIA

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
GFXV01006394    MBW18199.1    LBMM01008151    KMQ89105.1    LBMM01012479    KMQ86204.1    + More
LBMM01013040    KMQ85849.1    KQ971355    EFA07205.2    GBXI01015889    JAC98402.1    LBMM01013103    KMQ85815.1    GEZM01003178    JAV96889.1    KL367564    KFD63933.1    ABLF02030693    ABLF02030697    DF142933    GAA49140.1    GBXI01017046    JAC97245.1    FN356213    CAX83702.1    AAGJ04130731    LBMM01001181    KMQ96765.1    EF426679    ABP48077.1    KL363241    KFD51254.1    AY013563    AAK07485.1    HE601625    CCD77521.1    GEGO01003687    JAR91717.1    AAGJ04000250    KL367655    KFD60653.1    AY013569    AAK07487.1    KL367778    KFD59660.1    AY013565    AAK07486.1    KL367544    KFD65142.1    MRZV01000532    PIK48264.1    KL367543    KFD65158.1    LN877232    CTR11708.1    JYDK01000186    KRX73103.1    JYDK01000100    KRX76473.1    JYDK01000369    KRX69330.1    JYDR01000355    KRY64563.1    GBXI01003773    JAD10519.1    GGLE01003443    MBY07569.1    JYDV01000002    KRZ45603.1    JYDV01000289    KRZ22781.1    GFDL01003994    JAV31051.1    GEGO01004475    JAR90929.1    JYDR01000002    KRY79251.1    MRZV01002078    PIK34788.1    GEGO01004484    JAR90920.1    GEGO01004649    JAR90755.1    KQ973093    EFA13472.2    LBMM01012134    KMQ86388.1    GEGO01003506    JAR91898.1    ABLF02057446    ABLF02059301    AAZX01023279    AAGJ04001742    GDHF01014424    JAI37890.1    GDHF01021808    JAI30506.1    AAZX01013940    GDHF01001116    JAI51198.1    GEGO01004686    JAR90718.1    LBMM01012160    KMQ86374.1    JYDT01000067    KRY86703.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    JYDJ01000353    KRX36608.1    ABLF02040931    ABLF02040938    GGFK01003401    MBW36722.1    BK004070    DAA04500.1    GGLE01001814    MBY05940.1    KFD63920.1    GGFK01003442    MBW36763.1    GFPF01012375    MAA23521.1    AAZX01006801    AAZX01023483    GEGO01000286    JAR95118.1    ABLF02007585    CABG01000050    CAZ37786.2    BK004066    DAA04495.1    JWZT01000221    KII74837.1    BN000802    CAJ00250.1    ABLF02005645    ABLF02042063    LBMM01012633    KMQ86092.1    JWZT01004124    KII64665.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JWZT01003175    KII67485.1    JWZT01002058    KII70465.1    GEGO01001281    JAR94123.1    AAZX01009606    GACK01008900    JAA56134.1    JWZT01001363    KII72172.1    GBYB01009311    JAG79078.1    GEDV01001796    JAP86761.1    QMKO01001896    RTG85859.1    MRZV01000197    PIK55880.1    KL367479    KFD72009.1    QMKO01001891    RTG85893.1    GGLE01002534    MBY06660.1    KL367558    KFD64270.1    GDKW01003376    JAI53219.1   
Pfam
PF00665   rve        + More
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
PF13359   DDE_Tnp_4
PF00077   RVP
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
Interpro
IPR000477   RT_dom        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR012337   RNaseH-like_sf       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR041373   RT_RNaseH       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR013032   EGF-like_CS       
IPR027806   HARBI1_dom       
IPR018061   Retropepsins       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
PDB
4OL8     E-value=2.57559e-70,     Score=678

Ontologies

Topology

Length:
917
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.188160000000001
Exp number, first 60 AAs:
0.0001
Total prob of N-in:
0.00654
outside
1  -  917
 
 

Population Genetic Test Statistics

Pi
192.005071
Theta
51.832864
Tajima's D
3.658287
CLR
0.444118
CSRT
0.996400179991001
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号