SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08969
Pre Gene Modal
BGIBMGA007792
Annotation
ABC_transporter_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.819
 

Sequence

CDS
ATGAATAGTGATGGGAGAGCCGGAGAAAATTCTAGTGCTGAGAAGCGAAGGAAGCCCCATAAGCCGAACATTTTGTCTCGTATATTTCTATGGTGGATGTGCCCCGTACTCGTTAAAGGAAATCAAAGAGACATTGTCGAGGATGACCTCATAATTCCGAAAAAGTCATTTAATTCTGAAAATCAAGGAGAGTATTTAGAAAGGTATTGGCTCCAAGAATATGAAGCCGCGATAAAGGAGAAAAGGGAGCCGTCATTGTGGACAGCTTTACGAAAAGCTTACTGGTTGGGATACATGCCGGGAGCTATCTACTTGATAATCATATCTGTCTTCAGGATAATTCAGCCGCTAGTATTCGCCGAACTGCTTTCCTACTGGTCAGTAGAAGCAACTATAACTCGACTAGAAGCAAGCTATTATGCTCTAGCACTTTTAGGTATAAACTTCATTAATATGATGTGTCAACATCACAATTCATTGTTTGTAGCGCGCTTTGGACTCAAGGTTAAAGTGGCTTGCTCATCTTTAGTATATAGAAAGTTGTTGCGCATGGACCAAGTAGCCTTAGGAGATGTAAGCGGAGGGAAACTGGTGAACCTGTTATCTAATGATGTTGCTAGATTCGACTACGCATTCATGTTTTTGCACTACCTCTGGGTGGTACCAGTTCAAGCGGCTGTAGTATTATATTTCTTATATTATATTTCTGCGGGATACGCACCGTTCGTCGGCTTCTTTGGGGTTGTGATTTTAATTCTACCTATACAAGCTGGTCTCACAAAATTGACCTCTGTGGTCAGAAGAGAAACTGCTCAGAGAACCGACCGAAGGATAAAATTGATGACGGAAATTATTAATGGCATTCAGGTTATTAAAATGTACGCATGGGAGAAACCGTTCCAAGCAATCGTCAAGGTGGCAAGAAACTTCGAAATGATAGCACTCAGGAAGTCTATATTCATTCGGAGTGTTTTCCTTGGTTTCATGCTGTTCACTGAAAGAAGTATAATATTTATAACATGTTTGACATTGTTACTTACGGGTAACCTTGTTACAGCTACTCTGATTTACCCTATTCAACAATACATCAGCATTATTCAAATCAATTTGACTATGATACTGCCTCTTGCCATTGCAAGTTTGTCTGAAATGCTGGTCTCGTTGGAACGCATTCAAAATTTCTTGGTGAAAGATGAAAGAGAGGACGTCCAAATAACACCAAAATCTTATGGAGATGATAATAGATTGATTTTCAACAACAAGGCATCGCTTGGCCCTCAAAACGAAATTATCCCAAAGAAATATTTAGCCACCGATGGCCAACTTGCCTCAACATTAACGAATGAACCAGTGCTTCAAACTGACCCAGCCGTGTGTGACTATCCCATAGAATTATCTAAAGTAGACGCCACATGGTCGTCATCAACAGATACTTCAGAAATGACACTAAGGAATATTAGTCTCAGAATAGGCAGAGGCAAACTTTGTGCTATAATTGGACCTGTTGGATCAGGAAAGTCATCCATTTTGCAAGTTCTTCTGAAAGAACTGCCGGTTTGCGGTGGTAGCCTGAGAATAAATGGGAGGCTTTCCTACGCGTGTCAAGAGTCTTGGCTGTTCCCTGCTACTGTGAGAGAAAACATTTTGTTTGGTTTGCCGTACGAATCACAGAAATATCACGAGGTGTGTAAAGCTTGTTCGTTGCTTCCTGATTTCAAACAATTTCCGTACGGAGACCTCTCCTTAGTTGGAGAGCGAGGAGTATCCTTGTCAGGGGGACAGCGTGCCAGAATTAATCTCGCTAGGGCTGTTTACCGAGAGGCCGACATTTACTTGCTAGATGATCCTCTCTCAGCAGTGGACGCCAACGTTGGCAGGCAGCTGTTTGACGGCTGTATCAAAGGATATCTACGGGGTCGAACTTGTGTCCTTGTAACCCATCAAATCCACTATCTTAAAGCAGCTGACATTATTGTCATACTGAACGAGGGGGCAATTGAAAACGTTGGTAGCTACGATGATTTGGTCAAGACCGGAACAGAGTTTTCGAAGCTGTTGACTAATCAAGAAAGCAACGATAATGAGAATGGCCCGGAAAAGAATTTCTTACGGGCTATATCGAAAATATCTACTAAGAGTGTTGAAGATCCAGATAACGAGAAGGTACAAGTGGAGGAAGAAGAGAAACGTGCCAAAGGAAATTTGAAATTCTCTGTTTTATACAAGTATTTGTCTGCAGTGAAATCATGGTTTCTAGTATTTTTGATGGTAGCCACATTAGTTATCACACAAGGATGTGCGATGTTCATAGATTATTGGCTGAGTTTTTGGACAAATCAAGTTGATGAGTATGAACAATCTTTAGCTGAGGGAGAAGAACCGAGCACAAGTTTGGACACGCAAGCCGGAGCGTATACTTTAGGAGTATACCTTTGGACTTATGGCGGAGTCATCTTAATCCTCATAGTGATCAGTCACGTCAGAATTTTAACTTTCGTCATTACGACTATGAGAGCTTCATCTAATTTTCATGATACCGTTTACAAAAAGTTGATTATCACAGTTATGCGATTCTTTGACATGAATCCCTCAGGTCGTGTGTTGAATCGTTTTTCAAAGGATATGGGTGCGATGGACGAATTCCTTCCGAGGAGTTTATTTGAAACTGTTCAGATGTATTTAACATTATGCAGTATACTTATTTTAAATGCTATAGCATTACCGTGGACGTTGATCCCAACAGCGGTACTTTTGATTCTCTTCTTCTTTCTCCTGAAATGGTACTTAAATGCTGCTCAAGCTGTAAAAAGATTAGAAGGCACAACTAAGAGTCCAGTACTCGGCATGATCAACTCTACCCTCACAGGTCTGTCTACGATCCGAAGTTCTAATTCACAAGGACGACTGCTAGAAATGTTTGATAACGCACAGAATCTCCACACGAGTGCATTTTATACGTTTGTTGGTGGATCAACTGCATTTGGTTTATATCTGGATGCGCTTTGCTTAGTTTATTTGGGAGTGATATTGACGATCTTCCTTGTAATCGACTTCAGTACTTTAATTCCCGTCGGTAGCGTGGGCTTGGCTGTGAGTCAGTCTATGGTGTTAACGATGATGCTGCAAATGGCGGCTCGATTCACAGCCGACTTCCTCGGACAAATGACGGCTGTCGAGAGAGTTCTCGAATATACCGAGCTTCCGATGGAAGAAAACATGTATGATGGATCCCAACTTCCCAAGGACTGGCCTACACACGGTCATATTGAATTTCAAAATCTATTTTTGAACTATTCTCAAGAAGATCCACCAGTACTCAAAGATTTAAACTTTGTAATTGAGAATGGTTGGAAGGTTGGAGTAGTCGGTCGAACCGGTGCCGGCAAGTCTTCTATGATATCCGCACTGTTCAGGCTGTACGACCTGCAAGGACACATCAGAATAGACGGAATCGATACCAACATCATCGCTAAAACGGAGCTAAGATCGAAGATTTCTATCATACCACAAGAACCGATTTTGTTCTCTGCATCGGTGCGATACAATTTGGACCCCTTCGACAGTTATAGCGACGACGAAATTTGGAGAGCTTTGGAACAGGTTGAACTGAAAGAGGTAATTCCAGCGCTCGATTATAAAGTGTCAGAAGGCGGCAGCAACTTTTCCGTCGGTCAGCGACAACTGGTATGTTTGGCTCGAGCTGTTTTGCGTTCTAACAAAATCCTTGTAATGGACGAGGCGACAGCCAACGTTGATCCTCAAACTGACGCGTTGATTCAGACGACGATACGTCGCGAGTTTGCGTCATGTACGGTGATCACGATCGCGCACCGACTCAACACGATCATGGATTCTGATCGCGTCCTGGTCATGGACAAAGGAGTTGTTGCCGAATACGATACTCCTTATGCTCTGCTCTCCGACCCCAATTCGATCTTCAGCTCGATGGTGCGCGAAACAGGAGATACAATGAGCAAAGTCCTCTTCCGAGTGGCTGAAGATAAACATCTTGGTAGAAATACAGAAAAATGA
Protein
MNSDGRAGENSSAEKRRKPHKPNILSRIFLWWMCPVLVKGNQRDIVEDDLIIPKKSFNSENQGEYLERYWLQEYEAAIKEKREPSLWTALRKAYWLGYMPGAIYLIIISVFRIIQPLVFAELLSYWSVEATITRLEASYYALALLGINFINMMCQHHNSLFVARFGLKVKVACSSLVYRKLLRMDQVALGDVSGGKLVNLLSNDVARFDYAFMFLHYLWVVPVQAAVVLYFLYYISAGYAPFVGFFGVVILILPIQAGLTKLTSVVRRETAQRTDRRIKLMTEIINGIQVIKMYAWEKPFQAIVKVARNFEMIALRKSIFIRSVFLGFMLFTERSIIFITCLTLLLTGNLVTATLIYPIQQYISIIQINLTMILPLAIASLSEMLVSLERIQNFLVKDEREDVQITPKSYGDDNRLIFNNKASLGPQNEIIPKKYLATDGQLASTLTNEPVLQTDPAVCDYPIELSKVDATWSSSTDTSEMTLRNISLRIGRGKLCAIIGPVGSGKSSILQVLLKELPVCGGSLRINGRLSYACQESWLFPATVRENILFGLPYESQKYHEVCKACSLLPDFKQFPYGDLSLVGERGVSLSGGQRARINLARAVYREADIYLLDDPLSAVDANVGRQLFDGCIKGYLRGRTCVLVTHQIHYLKAADIIVILNEGAIENVGSYDDLVKTGTEFSKLLTNQESNDNENGPEKNFLRAISKISTKSVEDPDNEKVQVEEEEKRAKGNLKFSVLYKYLSAVKSWFLVFLMVATLVITQGCAMFIDYWLSFWTNQVDEYEQSLAEGEEPSTSLDTQAGAYTLGVYLWTYGGVILILIVISHVRILTFVITTMRASSNFHDTVYKKLIITVMRFFDMNPSGRVLNRFSKDMGAMDEFLPRSLFETVQMYLTLCSILILNAIALPWTLIPTAVLLILFFFLLKWYLNAAQAVKRLEGTTKSPVLGMINSTLTGLSTIRSSNSQGRLLEMFDNAQNLHTSAFYTFVGGSTAFGLYLDALCLVYLGVILTIFLVIDFSTLIPVGSVGLAVSQSMVLTMMLQMAARFTADFLGQMTAVERVLEYTELPMEENMYDGSQLPKDWPTHGHIEFQNLFLNYSQEDPPVLKDLNFVIENGWKVGVVGRTGAGKSSMISALFRLYDLQGHIRIDGIDTNIIAKTELRSKISIIPQEPILFSASVRYNLDPFDSYSDDEIWRALEQVELKEVIPALDYKVSEGGSNFSVGQRQLVCLARAVLRSNKILVMDEATANVDPQTDALIQTTIRREFASCTVITIAHRLNTIMDSDRVLVMDKGVVAEYDTPYALLSDPNSIFSSMVRETGDTMSKVLFRVAEDKHLGRNTEK

Summary

EMBL
AB620074    BAK82126.1    AB620075    BAK82127.1    JQ774504    AFI44049.1    + More
KP400523    AKV71230.1    KP400524    AKV71231.1    GQ332571    ADH16740.1    NWSH01001057    PCG72886.1    ODYU01009083    SOQ53247.1    KY489760    ASA45739.1    MG387056    AUE23770.1    MG387055    AUE23769.1    KY646296    AUO38740.1    MG387043    AUE23766.1    GQ332573    ADH16744.1    MG387057    AUE23771.1    MG387051    AUE23768.1    MG387058    AUE23772.1    KJ930171    AJD79136.1    KF479231    AHL68986.1    MF929077    AVE17269.1    KF926099    AIB06821.1    KM360184    AKH49600.1    KY701524    AVV62499.1    KM360192    AKH49608.1    KM068116    AJY53612.1    MG387063    AUE23774.1    MG387050    AUE23767.1    MG387068    AUE23775.1    MG387062    AUE23773.1    KJ930167    AJD79134.1    KC758896    AGO01048.1    JN030495    AEI27596.1    KM245561    AKC96180.1    KM103521    AIS93186.1    KJ930169    AJD79135.1    RSAL01000049    RVE50388.1    JN030490    AEI27592.1    KQ459602    KPI93323.1    JN030491    AEI27593.1    AGBW02009058    OWR51775.1    KX710207    ASU47347.1    KF926100    AIB06822.1    KM232756    AKC34055.1    KF479232    AHL68987.1    KM250380    AKC34056.1    AVV62500.1    KY646297    AUO38741.1    KF926101    AIB06823.1    KF926102    AIB06824.1    OWR51776.1    PCG72885.1    KJ930170    AJD79133.1    KM245562    AKC96181.1    KQ460615    KPJ13567.1    RVE50389.1    KX710208    ASU47346.1    KPI93322.1    KJ930168    AJD79132.1    AB621548    BAK86406.1    KM245560    AKC96179.1    AVV62497.1    RSAL01000187    RVE44791.1    ODYU01012016    SOQ58094.1    SOQ53245.1    KQ971342    EFA03948.2    KY484779    ASS36021.1    GDHC01020387    GDHC01013422    JAP98241.1    JAQ05207.1    GBYB01005573    JAG75340.1    GGFJ01000531    MBW49672.1    MH172501    QAA95908.1    NWSH01000076    PCG79892.1    KF828786    AIN44103.1    GDKW01000545    JAI56050.1    GECL01002731    JAP03393.1    AAZX01002657    QOIP01000007    RLU20304.1    GEZM01016983    GEZM01016981    JAV90996.1    GL888807    EGI58005.1    GEZM01016982    JAV90994.1    KQ977121    KYN05546.1    ADMH02000892    ETN64739.1    JRES01000264    KNC32832.1    KZ288215    PBC32516.1    CH916374    EDV91220.1    GFDF01003930    JAV10154.1    AAAB01008960    EAA10720.3    GFDF01003929    JAV10155.1    JRES01000405    KNC31638.1    RLU20387.1    ADTU01019789    ADTU01019790    KA646208    AFP60837.1    CVRI01000059    CRL03663.1    GFDL01013712    JAV21333.1   
Pfam
PF00664   ABC_membrane        + More
PF00005   ABC_tran
Interpro
IPR003593   AAA+_ATPase        + More
IPR017871   ABC_transporter_CS       
IPR003439   ABC_transporter-like       
IPR036640   ABC1_TM_sf       
IPR027417   P-loop_NTPase       
IPR011527   ABC1_TM_dom       
IPR000788   RNR_lg_C       
IPR029063   SAM-dependent_MTases       
SUPFAM
SSF90123   SSF90123        + More
SSF52540   SSF52540       
SSF53335   SSF53335       
Gene 3D
PDB
5UJA     E-value=0,     Score=1644

Ontologies

Topology

Length:
1343
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
249.379030000001
Exp number, first 60 AAs:
0.07952
Total prob of N-in:
0.98516
inside
1  -  92
TMhelix
93  -  115
outside
116  -  129
TMhelix
130  -  152
inside
153  -  211
TMhelix
212  -  234
outside
235  -  243
TMhelix
244  -  266
inside
267  -  336
TMhelix
337  -  359
outside
360  -  362
TMhelix
363  -  385
inside
386  -  749
TMhelix
750  -  772
outside
773  -  807
TMhelix
808  -  830
inside
831  -  898
TMhelix
899  -  921
outside
922  -  993
TMhelix
994  -  1016
inside
1017  -  1022
TMhelix
1023  -  1045
outside
1046  -  1343
 
 

Population Genetic Test Statistics

Pi
183.412551
Theta
156.088605
Tajima's D
0.601206
CLR
0.034426
CSRT
0.544472776361182
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号